2015 film
POPULARITY
Prendendo spunto dalla presenza del suo ultimo film nel Fuori concorso del Torino Film festival, parliamo della luce del cinema “di immagini da costruire” del regista rumeno Radu Jude. Nella puntata, poi, parliamo anche della nuova edizione del Torino Film Festival, dell'accordo che ha posto fine alla sciopero degli attori di Hollywood e del Giunti Odeon Libreria Cinema.Qui l'indice della puntata:00:30 News: aggiornamenti editoriali su Linkinmovies.it02:12 News: descrizione della nuova libreria-cinema Giunti Odeon Libreria Cinema di Firenze04:29 News: è stato trovato l'accordo tra il sindacato attori di Hollywood, SAG-AFTRA e l'associazione che difende gli studios, AMPTP. Lo scorso 10 novembre è finito lo sciopero degli attori. 07:07 News: presentazione della 41esima edizione del Torino Film Film festival (24 novembre-2 dicembre 2023) https://www.torinofilmfest.org/it/11:36 La Luce del Cinema di Radu Jude. Film analizzati (riportiamo il titolo in inglese): The happiest girl in the world; Everybody in our family; Aferim!; Scarred hearts; The dead nations; I do not care if we go down in history as barbarians; Uppercase print; Sesso sfortunato o follie porno (Bad luck banging or loony porn); Do not expect too much from the end of the world.
Quality of Mercy S1E19 (17 Aug 94) vs. Crossover S2E23 (15 May 94) -Matt maybe coins a phrase for a common sf trope: hardluck telepathy, examples from the X-Men include: Jean Grey, Emma Frost, Betsy Braddock, Kwannon, David Haller, Xi'an Coy Manh, Dani Moonstar, Quentin Quire, David Alleyne, & Stepford Cuckoos -Matt educates Bob on ‘Cult of Personality'-All the talk of spacing puts Bob in mind of the famous hard sf tale 'Cold Equations', although it's arguably a bit ridiculous & pretty sexist-Magneto gets mindwiped in the climax of Fatal Attractions (1993)-Bob was foolishly misremembering the concept of Wolverine's adamantium skeleton as being introduced in Weapon X (1991), but it was much earlier in Proteus Saga (1979), although Wolverine's unbreakable bones were alluded to before-June Lockhart played Dr. Maureen Robinson in the original Lost in Space (1965-8) & Dr. Rosen in this episode; sadly, there's no reunion with Bill Mumy-The best popular book on M4A is Tim Faust Health Justice Now: Single Payer & What Comes Next (2019)-Bob references Sigmund Freud's very short essay “Medusa's Head” (1922). The best & funnest popular introduction to psychoanalysis is Slavoj Žižek Looking Awry: An Introduction to Jacques Lacan through Popular Culture (1991) -Bob & Matt compare the many episodes, comics, & novels set in the Mirror Universe-Bob again waxes nostalgic about Diane Duane Star Trek novels-Bob praises the Star Trek comics crossovers w/ Planet of the Apes (2015) & Legion of Super-Heroes (2012) & condemns the Dr. Who crossover (2012)-Matt references an Odo retcon in the David Mack Section 31 novel Disavowed (2014)-Great if controversial movies involving slavery include Burn! (1969), Mandingo (1975), Drum (1976), Django Unchained (2012), 12 Yrs a Slave (2013), Aferim! (2015), & Free State of Jones (2016)
Regizorul Radu Jude a început să lucreze în film ca asistent de regie pentru filme ca Amen., în regia lui Costa Gavras sau Moartea domnului Lăzărescu, în regia lui Cristi Puiu. După mai multe scurt metraje premiate, a debutat în lung metraj cu Cea mai fericită fată din lume, un film care spune cu umor povestea conflictului dintre o fată și părinții ei în urma câștigării unei mașini la un concurs. De atunci, Radu a realizat câte un film aproape în fiecare an, un ritm care îl ajută să experimenteze regizoral fără să pună pe el presiunea de a realiza o capodoperă. În ultimii ani, s-a făcut remarcat pentru filme ca Aferim! sau Îmi este indiferent dacă în istorie vom intra ca barbari în care arată bucăți de istorie mai puțin discutate, cum ar fi sclavia romilor sau Masacrul de la Odessa. Anul acesta, cel mai recent film al său, Babardeală cu bucluc sau porno balamuc, care invită la o discuție despre vulgaritatea și agresivitatea din societate, a câștigat premiul Ursul de Aur la Festivalul de Film de la Berlin. Podcastul Pe Bune este prezentat de UniCredit Bank, o companie care crede în puterea minților creative. Credits: Temă muzicală: Alex Turcu. Editor sunet: Horia Baldea. Asistent de producție: Alina Șincu. Muzică adițională: Lee Rosevere – Southside.
We're thrilled to share our talk with Radu Jude and Ada Solomon, both winners of the Golden Bear 2021. The director/producer duo from Romania will give us insights in the making of THE HAPPIEST GIRL IN THE WORLD, Radu Jude's feature film debut. The interview was conducted online on the 15.04.2021. Synopsis: “Delia, a young Romanian girl, comes to Bucharest with her parents to collect a prize she has won in a contest organized by a soft-drinks company. The prize is a beautiful new car. All Delia has to do now is appear in front of the camera in a commercial. All goes well until it becomes clear that Delia and her parents have very different ideas about what to do with the new car. Meanwhile, the contest's sponsor needs a radiant prize-winner with a gleaming smile. A wicked satire and a psychological portrait of a society perverted by its slavery to capitalism and consumerism.” About the filmmakers:Radu Jude was born in Bucharest, Romania in 1977. He has a degree in film from the city's Media University. He began his career as an assistant director before making his first short, The Tube with the Hat, in 2006. His feature debut, THE HAPPIEST GIRL IN THE WORLD, screened in the 2009 Forum and garnered worldwide attention. He won the Silver Bear for Best Director at the 2015 Berlinale with AFERIM!. In 2017, Locarno screened his first documentary: THE DEAD NATION. His next documentary, THE EXIT OF THE TRAINS, premiered in the 2020 Forum. His film UPPERCASE PRINT mixes fiction with documentary and theatre methods and premiered in the 2020 Forum as well. His latest film, BAD LUCK BANGING OR LOONY PORN won the Golden Bear in Berlin in 2021. Here is a cinematic self portrait he shot. Ada Solomon was born on June 3, 1968 in Bucharest, Romania. She is the founder of Hi Film Productions and Micro Film. Her credits include BAD LUCK BANGING OR LOONY PORN (Radu Jude, 2021, Golden Bear Berlin), I DO NOT CARE IF WE GO DOWN IN HISTORY AS BARBARIANS (Radu Jude, 2018, Grand Prix Crystal Globe in Karlovy Vary IFF), AFERIM! (Radu Jude, 2015, Silver Bear Berlin) and CHILD'S POSE (Calin Peter Netzer, 2013, Golden Bear Berlin). She has worked with most promising filmmakers from Romania, from Cristian Nemescu to Ivana Mladenovic, from Alexandru Solomon and Răzvan Rădulescu to Adrian Sitaru and Paul Negoescu - to name just a few. Ada has co-produced with over 15 European countries and has released her films in over 50 territories. She has been in charge of production services for projects such as Franco Zeffirelli's CALLAS FOREVER and Maren Ade's Oscar-nominated TONI ERDMANN. She is the Executive President of the European Women's Audiovisual Network, the Deputy Chairwoman of the European Film Academy Board.
For this episode I had the pleasure to meet Ștefan Ionescu-Ambrosie - a Romanian writer and researcher currently based in Barcelona. His work was published among others in KAJET Journal, Hinterlands Magazine, [Inter]Sections Journal and Norient. Ștefan is also an author of praznumen - a blog dedicated to writings on cinema, books, video games, music and dance. During our Kitchen Conversations we mainly discussed two cultural trends in contemporary Romania: The New Wave and manele subculture, both in relation to mental health and intergenerational trauma. References: blog praznumen // Romanian Revolution // What is Gopnic? // Manele – Memeified Music // The Death of Mr. Lazarescu (New Wave example) // Aferim! (trailer) // Florin Salam - Saint Tropez (manele example) // How manele are being used by more progressive millennial voices in Romania Favourite home food: Romanian Bean Soup Become my Patron: https://www.patreon.com/kitchenconversations Help me grow my podcast with a single donation: https://www.paypal.com/donate/?hosted_button_id=53QSW2BLPWD4U Follow me on Instagram: @patrycja.rozwora
Ada Solomon este poate cel mai cunoscut producător de film din țară. Numele ei a apărut pentru prima dată pe un generic în calitate de director de producție în 1995 la Asfalt Tango de Nae Caranfil. De atunci a produs peste 60 de filme, multe câștigând premii naționale și internaționale, cum ar fi Poziția Copilului, Aferim! sau Toni Erdmann. Ada spune că nu premiile reprezintă o reușită pentru ea, ci faptul că a reușit să ducă la bun sfârșit filmele uneori în condiții dificile sau toate lucrurile pe care le-a învățat din fiecare colaborare. Despre succes mai spune că a descoperit că poate fi o experiență care generează un sentiment de singurătate, pentru că succesul a îndepărtat într-o perioadă oamenii dragi de lângă ea. Cel mai mult, în filmele pe care le produce, o interesează să găsească acele povești mici și particulare care vorbesc de fapt despre probleme și teme universale dintr-o societate, și care îi provoacă pe spectatori să-și pună întrebări despre lume. Producția unor astfel de filme este forma ei de activism civic. Podcastul Pe Bune este prezentat de UniCredit Bank și susținut de BestJobs și Samsung România, companii care cred în puterea minților creative. Credits: Temă muzicală: Alex Turcu. Editor sunet: Horia Baldea. Asistent de producție: Alina Șincu. Muzică adițională: Lobo Loco – Lucky Nightwalk; Lobo Loco - Running Eiskrokodil.
El primer largometraje de Radu Jude es un drama histórico, pero que uno que no busca contar un gran hecho ni pintar el retrato de un gran personaje, sino usar una anécdota minúscula capaz de contener las relaciones de poder y de producción feudales sobrevivientes en el S. XIX rumano. Los diálogos exponen hechos, pero sobre todo la ideología que recubre un sistema que se ve lejano y cercano al mismo, pero sobre todo aberrante. Y logra todo esto sin activismo ni estridencia, mientras muestra en cámara la evolución de una conciencia que no se va a detener. De eso y más hablamos en el podcast.
Kárpáti György Mór a berlini, majd a cannes-i fesztiválra meghívott kisfilmekkel vétette észre magát, most pedig előállt első nagyjátékfilmjével, az 1848-49-es forradalom és szabadságharc leverése után játszódó Guerillá-val. Mesélt arról, milyen volt Enyedi Ildikó osztályába járni, mit tanult az Egy nap-on dolgozva, ahol casting director volt, és azt is elárulta, mik azok a nagy kérdések, amik a Guerilla kapcsán foglalkoztatták. Szóba került az Aferim! című román western, mint pozitív példa a történelmi filmekre, illetve két őséről is beszélt – az egyik Damjanich seregében szolgált, a másik Amerikáig ment az elsikkasztott pénzzel.
Am stat de vorba cu Marius Panduru, unul dintre cei mai apreciati directori de imagine de film din Romania. Cateva din filmele la care Marius a fost Director de imagine sunt Aferim, Restul e tacere, Cea mai fericita fata, Periferic, De ce eu?, si restul listei il gasiti aici - https://goo.gl/yjGWgp. Nu aveam cum sa-l invit pe Marius si sa nu vorbim despre filmele la care a lucrat, despre pelicula versus digital, dar si despre avioane si carti. Recomandarile lui Marius: Pentru film, musai Godard - lista cu filmele lui aici - https://goo.gl/KHUXRo Children of Men - film la care a fost DoP Lubezki, zis si Chivo - https://goo.gl/QhZQS1 Filme regizate de Hsiao-Hsien Hou - https://goo.gl/2tXYvw Pentru carti: Ian Buruma - https://goo.gl/CEXAYJ Giorgio Agamben - https://goo.gl/k9txYK Victor Ieronim Stoichita - pentru pasionatii de film si fotografie - https://goo.gl/qTaq74 Ivo Andric - E un pod pe Drina - https://goo.gl/HCKEU8
Romano kulturako kurko lel pe adjes ando Malmö thaj kado inkrel pe intrego kurko. Rumonitsko kulturako-institut mukhlas jekh kino kaj bushol AFERIM khaj si pa romane slavura ande purane vrami. "Romani chib si vazno feri te na vorbija pe kadi chib shaja e chib te hasajvel.
Első évadunk lezárása után, és a második évad megkezdése előtt két különleges epizóddal készültünk. Az e heti műsorban olyan filmeket pótoltunk be, amelyek szigorú értelemben véve nem felelnek meg a Vakfolt podcast célkitűzéseinek, mert viszonylag frissek, nem tekinthetők régóta bepótlásra váró popkulturális hiányosságoknak. Az egyik ilyen film a 2014-es A Girl Walks Home Alone at Night (magyarul Csadoros Vérszívó), amelyet Péter nem látott korábban, illetve a 2015-ös Aferim!, amelyet András választott. Hogyan fér meg egymás mellett a vámpírhorror az indie románccal, és mi fán terem a havasalföldi western? Mit kell, vagy mit nem kell mondania a 2010-es években egy Iránban játszódó iráni filmnek, amit nő rendezett? Hogyan lehet manapság releváns egy 1830-as években játszódó történet? Fekete-fehér adásunkban (igen, fekete-fehérben vettük fel, tessék hozzáképzelni) beszélünk a hanghatásokkal való stimulálásról, a csendes pillantások és a szószátyár szövegelések másfajta erényeiről, de szóba kerül az antihősök természete is. A Kitekintő rovatot is nélkülöztük a rendhagyó adásban, helyette kicsit visszatekintettünk az előző 19 epizódunkra. Linkek: A Vakfolt podcast facebook oldala Vakfolt címke a Letterboxdon András a Twitteren: @gaines_ Péter a Twitteren: @freevo Emailen is elértek bennünket: feedback@vakfoltpodcast.hu A főcímzenénket az Artúr zenekar szerezte, akiket megtaláltok a Facebookon és aTwitteren is.
The Gods want to believe...the new X-Files blu-ray is good! Plus, new releases from Tiny Fey, Ryan Reynolds, Matt Damon and Dwayne Johnson. DigiGods Podcast, 06/28/16 (MP3) — 35.26 MB right click to save Subscribe to the DigiGods Podcast In this episode, the Gods discuss: Aferim! (Blu-ray) Alaskan Bush People: Seasons 1 and 2 (DVD) Anesthesia (Blu-ray) Angie Tribeca: The Complete First Season (DVD) Ballers: The Complete First Season (Blu-ray) Cemetery of Splendor (Blu-ray) Clouds of Sils Maria (Blu-ray) Dark Matter: Season 1 (Blu-ray) Dr. Strangelove, or: How I Learned to Stop Worrying and Love the Bomb (Blu-ray) Embrace of the Serpent (Blu-ray) Everything Will Be Fine (Blu-ray) Eye in the Sky (Blu-ray/DVD) Fantastic 4 (4k UHD Blu-ray) French Village: Season 2 (DVD) French Village: Season 3 (DVD) Going Away (Blu-ray) Have Gun - Will Travel: The Complete Series (DVD) Hello, My Name is Doris (DVD) Hitman: Agent 47 (4k UHD Blu-ray) How to Get Away With Murder Season 2 (DVD) Independence Day 20th Anniversary Edition (4k UHD Blu-ray) Kung Fu Panda 3 (Blu-ray) The League - The Final Fantasy (DVD) Life of Pi (4k UHD Blu-ray) Major Crimes: The Complete Fourth Season (DVD) Margarita, With a Straw (DVD) The Martian - Extended Cut (4k UHD Blu-ray) Maude: Season Five (DVD) Maze Runner: The Scorch Trials (4k UHD Blu-ray) Midnight Special (Blu-ray) My Big Fat Greek Wedding 2 (Blu-ray/DVD) Paris Belongs to Us (Blu-ray) Precious Cargo (Blu-ray) Really Weird Tales (DVD) Rizzoli & Isles: The Complete Sixth Season (DVD) Shark Week: Jawsome Encounters (DVD) Spiral: Season 5 (DVD) Toni Braxton: The Movie Event (DVD) Two Guys and a Girl - The Complete Series (DVD) Underground: Season One (DVD) A War (Blu-ray) The Wave (Blu-ray) Whiskey Tango Foxtrot (Blu-ray/DVD) Wild (4k UHD Blu-ray) Workaholics Season Six (DVD) X-Files: The Event Series (Blu-ray) Please also visit CineGods.com.
Dosta je bilo zajebancije! A sad malo o stilskim obilježjima suvremenog europskog filma kroz četiri primjera: "Saulovog sina", "Aferim!", "S one strane" i "The Brothers Grimsby".
I veckans avsnitt av EU-migranterna tittar vi på hur dagens korruption och det romska slaveriet som pågick i Rumänien i femhundra år skildras i rumänsk film. I serien EU-migranterna följer vi de svenska journalisterna Aaron Israelson och Nana Håkansson som har lämnat Sverige för att bo och arbeta i Rumänien. Aaron planerar att starta en gatutidning i Bukarest som ska säljas av fattiga romer, medan journalisten Nana gör sitt yttersta för att bli rumänsk kulturkvinna och proffsminglare i den rumänska huvudstaden. Samtidigt ger de oss nya perspektiv från Rumänien, ett land som i Sverige ofta förknippas med en kommunistdiktator som avrättades för 25 år sedan, korruption, fattigdom, romofobi och personer som reser utomlands för att tigga.Och även film under de senaste tio åren har rumänsk film slagit stort utanför landets gränser, kammat hem priser i Cannes, Venedig och Berlin och också letat sig in i de svenska biosalongerna. Härom året var Rumänien också temaland på filmfestivalen i Göteborg. Landets senaste storfilm Aferim! handlar om en undamgömd del av den rumänska historien, nämligen om hur romer hölls som om slavar fram till mitten av 1800-talet. I det tredje avsnittet av EU-migranterna träffar Nana Håkansson och Aaron Israelson filmens regissör Radu Jude.Aferim! är Rumäniens bidrag till Oscarsgalan i år, men en annan nästan lika omtalad film är De ce eu som handlar om den den politiska mutkulturen i Rumänien. Apropå detta dricker Nana och Aaron kaffe med Laura Codrua Kövesi, som är chef för den rumänska anti-korruptionsbyrån DNA där 120 åklagare för tillfället arbetar med 6000 misstänkta fall. Förra året utredde myndigheten tolv parlamentsledarmöter, varav två före detta ministrar. Programmet EU-migranterna produceras i Nana Håkanssons lägenhet i Bukarest och är en mix mellan köksbordstalkshow och reportageradio från gator och salonger. Producent: Tommie JönssonProgramserien EU-migranterna görs av produktionsbolaget Rundfunk Media för Sveriges Radio.
Aferim! - A special journey into Romanian past and a unique film to produce. The post Ada Solomon – Aferim! #Berlinale appeared first on Fred Film Radio.
Riding a horse - The most challenging scenes ever. The post Teodor Corban – Aferim! #Berlinale appeared first on Fred Film Radio.
Playing a brave and passionate gypsy slave The post Toma Cuzin – Aferim! #Berlinale appeared first on Fred Film Radio.
AFERIM!, A Western Inspired Gipsy tale to trace the roots of every prejudice and racism in modern society. The post Radu Jude – Aferim! #Berlinale appeared first on Fred Film Radio.
Playing a brave and passionate gypsy slave The post Toma Cuzin – Aferim! #Berlinale appeared first on Fred Film Radio.
Playing a brave and passionate gypsy slave The post Toma Cuzin – Aferim! #Berlinale appeared first on Fred Film Radio.
Riding a horse - The most challenging scenes ever. The post Teodor Corban – Aferim! #Berlinale appeared first on Fred Film Radio.
Aferim! - A special journey into Romanian past and a unique film to produce. The post Ada Solomon – Aferim! #Berlinale appeared first on Fred Film Radio.
AFERIM!, A Western Inspired Gipsy tale to trace the roots of every prejudice and racism in modern society. The post Radu Jude – Aferim! #Berlinale appeared first on Fred Film Radio.
Playing a brave and passionate gypsy slave The post Toma Cuzin – Aferim! #Berlinale appeared first on Fred Film Radio.
Riding a horse - The most challenging scenes ever. The post Teodor Corban – Aferim! #Berlinale appeared first on Fred Film Radio.
Aferim! - A special journey into Romanian past and a unique film to produce. The post Ada Solomon – Aferim! #Berlinale appeared first on Fred Film Radio.
AFERIM!, A Western Inspired Gipsy tale to trace the roots of every prejudice and racism in modern society. The post Radu Jude – Aferim! #Berlinale appeared first on Fred Film Radio.
Aferim! - A special journey into Romanian past and a unique film to produce. The post Ada Solomon – Aferim! #Berlinale appeared first on Fred Film Radio.
Riding a horse - The most challenging scenes ever. The post Teodor Corban – Aferim! #Berlinale appeared first on Fred Film Radio.
Aferim! - A special journey into Romanian past and a unique film to produce. The post Ada Solomon – Aferim! #Berlinale appeared first on Fred Film Radio.
AFERIM!, A Western Inspired Gipsy tale to trace the roots of every prejudice and racism in modern society. The post Radu Jude – Aferim! #Berlinale appeared first on Fred Film Radio.
Playing a brave and passionate gypsy slave The post Toma Cuzin – Aferim! #Berlinale appeared first on Fred Film Radio.
Riding a horse - The most challenging scenes ever. The post Teodor Corban – Aferim! #Berlinale appeared first on Fred Film Radio.
Aferim! - A special journey into Romanian past and a unique film to produce. The post Ada Solomon – Aferim! #Berlinale appeared first on Fred Film Radio.
AFERIM!, A Western Inspired Gipsy tale to trace the roots of every prejudice and racism in modern society. The post Radu Jude – Aferim! #Berlinale appeared first on Fred Film Radio.
Playing a brave and passionate gypsy slave The post Toma Cuzin – Aferim! #Berlinale appeared first on Fred Film Radio.
Riding a horse - The most challenging scenes ever. The post Teodor Corban – Aferim! #Berlinale appeared first on Fred Film Radio.
AFERIM!, A Western Inspired Gipsy tale to trace the roots of every prejudice and racism in modern society. The post Radu Jude – Aferim! #Berlinale appeared first on Fred Film Radio.
gatgcgctagcatcgatagcatcaagagctcgatcagctagcatacagcta gatgcgatagcatcgatagcatcaagagctcgatcagctagcatccagcta gatgcgctagcatcgatcgcatcaagagctcgatcagctagcatacagcta gatgcgctagcatcgatagcatcaagagctcgatcagctagcatgcagcta gatgcgatagcatcgatagcatcaagagctcgatcagctagcatacagcta İ – Aysu, ağzımdan bakteri topladım, bak. A – Aferim. İ – Ya bak bi, hepsini sekansladım, ama hepsi aynı galiba. Çok güzel. A – Of İlker ya, gidip tez defansına hazırlansana ağzını karıştıracağına. İ – Ya bi bak yahu, n’olur yani, seninkine de bakalım sonra. A – Ya […]