Medizin - Open Access LMU - Teil 18/22

Tauopathies are widespread neurodegenerative disorders characterised by the intracellular accumulation of hyperphosphorylated tau. Especially in Alzheimer's disease, pathological alterations in the retina are discussed as potential biomarkers to improve early diagnosis of the disease. Using mice expressing human mutant P301S tau, we demonstrate for the first time a straightforward optical approach for the in vivo detection of fibrillar tau in the retina. Longitudinal examinations of individual animals revealed the fate of single cells containing fibrillar tau and the progression of tau pathology over several months. This technique is most suitable to monitor therapeutic interventions aimed at reducing the accumulation of fibrillar tau. In order to evaluate if this approach can be translated to human diagnosis, we tried to detect fibrillar protein aggregates in the post-mortem retinas of patients that had suffered from Alzheimer's disease or Progressive Supranuclear Palsy. Even though we could detect hyperphosphorylated tau, we did not observe any fibrillar tau or Aß aggregates. In contradiction to previous studies, our observations do not support the notion that Aβ or tau in the retina are of diagnostic value in Alzheimer's disease.

Sun, 1 Jan 2012 12:00:00 +0100 https://epub.ub.uni-muenchen.de/12335/1/Kuss_Erich_12335.pdf Kuß, Erich

The TLR7 agonist imiquimod has been used successfully as adjuvant for skin treatment of virus-associated warts and basal cell carcinoma. The effects of skin TLR7 triggering on respiratory leukocyte populations are unknown. In a placebo-controlled experimental animal study we have used multicolour flow cytometry to systematically analyze the modulation of respiratory leukocyte subsets after skin administration of imiquimod. Compared to placebo, skin administration of imiquimod significantly increased respiratory dendritic cells (DC) and natural killer cells, whereas total respiratory leukocyte, alveolar macrophages, classical CD4+ T helper and CD8+ T killer cell numbers were not or only moderately affected. DC subpopulation analyses revealed that elevation of respiratory DC was caused by an increase of respiratory monocytic DC and CD11b(hi) DC subsets. Lymphocyte subpopulation analyses indicated a marked elevation of respiratory natural killer cells and a significant reduction of B lymphocytes. Analysis of cytokine responses of respiratory leukocytes after stimulation with Klebsiella pneumonia indicated reduced IFN-γ and TNF-α expression and increased IL-10 and IL-12p70 production after 7 day low dose skin TLR7 triggering. Additionally, respiratory NK cytotoxic activity was increased after 7d skin TLR7 triggering. In contrast, lung histology and bronchoalveolar cell counts were not affected suggesting that skin TLR7 stimulation modulated respiratory leukocyte composition without inducing overt pulmonary inflammation. These data suggest the possibility to modulate respiratory leukocyte composition and respiratory cytokine responses against pathogens like Klebsiella pneumonia through skin administration of a clinically approved TLR7 ligand. Skin administration of synthetic TLR7 ligands may represent a novel, noninvasive means to modulate respiratory immunity.

Sun, 1 Jan 2012 12:00:00 +0100 https://epub.ub.uni-muenchen.de/12712/1/Eymer_Bibliographie.pdf Eymer, Heinrich ddc:610, Medizin

High serum uric acid (UA) levels are associated with the metabolic syndrome, type 2 diabetes and cardiovascular disease. It is largely unknown whether there are gender-specific differences regarding the association between UA and prediabetic states. We examined the possible association between UA levels and known as well as newly diagnosed diabetes (NDD), isolated impaired fasting glucose (i-IFG), isolated impaired glucose tolerance (i-IGT), and combined IFG/IGT in a population-based sample of 32-to-81-year-old men and women. An oral glucose tolerance test was carried out in all 2,740 participants without known diabetes of the Cooperative Health Research in the Region of Augsburg (KORA) F4 Study conducted between 2006 and 2008 in Southern Germany. Serum UA was analysed by the uricase method. In women after multivariable adjustment the associations between UA and i-IFG (OR 1.57, 95% CI 1.15-2.14), IFG/IGT (OR 1.52, 1.07-2.16), NDD (OR 1.67, 95% CI 1.28-2.17), and known diabetes (OR 1.47, 95% CI 1.18-1.82) remained significant, but the association with i-IGT (OR 1.14, 95% CI 0.95-1.36) lost significance. In contrast in men, after multivariable adjustment there was only a significant association between UA levels and i-IFG (OR 1.49, 95% CI 1.21-1.84), all other associations were non-significant (i-IGT: OR 1.09, IFG/IGT: OR 1.06, NDD: OR 0.91, known diabetes: OR 1.04; all p-values>0.05). Serum UA concentrations were associated with different categories of impaired glucose regulation in individuals from the general population, particularly in women. Further studies investigating the role of UA in the development of derangements in glucose metabolism are needed.

Sun, 1 Jan 2012 12:00:00 +0100 https://epub.ub.uni-muenchen.de/12885/1/Kuss_Erich_12885.pdf Kuß, E

Background: Randomized, double-blind, placebo-controlled trials constitute the gold standard in clinical research when testing the efficacy of new psychopharmacological interventions in the treatment of major depression. However, the blinded use of placebo has been found to influence clinical trial outcomes and may bias patient selection. Discussion: To improve clinical trial design in major depression so as to reflect clinical practice more closely we propose to present patients with a balanced view of the benefits of study participation irrespective of their assignment to placebo or active treatment. In addition every participant should be given the option to finally receive the active medication. A research agenda is outlined to evaluate the impact of the proposed changes on the efficacy of the drug to be evaluated and on the demographic and clinical characteristics of the enrollment fraction with regard to its representativeness of the eligible population. Summary: We propose a list of measures to be taken to improve the external validity of double-blind, placebocontrolled trials in major depression. The recommended changes to clinical trial design may also be relevant for other psychiatric as well as medical disorders in which expectations regarding treatment outcome may affect the outcome itself.

Osteogenic repair in response to bone injury is characterized by activation and differentiation of mesenchymal stem cells (MSCs) to osteoblasts. This study determined whether activation of Sirt-1 (a NAD(+)-dependent histone deacetylase) by the phytoestrogen resveratrol affects osteogenic differentiation. Monolayer and high-density cultures of MSCs and pre-osteoblastic cells were treated with an osteogenic induction medium with/without the Sirt-1 inhibitor nicotinamide or/and resveratrol in a concentration dependent manner. MSCs and pre-osteoblastic cells differentiated to osteoblasts when exposed to osteogenic-induction medium. The osteogenic response was blocked by nicotinamide, resulting in adipogenic differentiation and expression of the adipose transcription regulator PPAR-γ (peroxisome proliferator-activated receptor). However, in nicotinamide-treated cultures, pre-treatment with resveratrol significantly enhanced osteogenesis by increasing expression of Runx2 (bone specific transcription factor) and decreasing expression of PPAR-γ. Activation of Sirt-1 by resveratrol in MSCs increased its binding to PPAR-γ and repressed PPAR-γ activity by involving its cofactor NCoR (nuclear receptor co-repressor). The modulatory effects of resveratrol on nicotinamide-induced expression of PPAR-γ and its cofactor NCoR were found to be mediated, at least in part, by Sirt-1/Runx2 association and deacetylation of Runx2. Finally, knockdown of Sirt-1 by using antisense oligonucleotides downregulated the expression of Sirt-1 protein and abolished the inhibitory effects of resveratrol, namely nicotinamide-induced Sirt-1 suppression and Runx2 acetylation, suggesting that the acetylated content of Runx2 is related to downregulated Sirt-1 expression. These data support a critical role for Runx2 acetylation/deacetylation during osteogenic differentiation in MSCs in vitro. (242 words in abstract).

Sun, 1 Jan 2012 12:00:00 +0100 https://epub.ub.uni-muenchen.de/14120/1/Kuss_14120.pdf Kuß, Erich

Background: For several immune-mediated diseases, immunological analysis will become more complex in the future with datasets in which cytokine and gene expression data play a major role. These data have certain characteristics that require sophisticated statistical analysis such as strategies for non-normal distribution and censoring. Additionally, complex and multiple immunological relationships need to be adjusted for potential confounding and interaction effects. Objective: We aimed to introduce and apply different methods for statistical analysis of non-normal censored cytokine and gene expression data. Furthermore, we assessed the performance and accuracy of a novel regression approach in order to allow adjusting for covariates and potential confounding. Methods: For non-normally distributed censored data traditional means such as the Kaplan-Meier method or the generalized Wilcoxon test are described. In order to adjust for covariates the novel approach named Tobit regression on ranks was introduced. Its performance and accuracy for analysis of non-normal censored cytokine/gene expression data was evaluated by a simulation study and a statistical experiment applying permutation and bootstrapping. Results: If adjustment for covariates is not necessary traditional statistical methods are adequate for non-normal censored data. Comparable with these and appropriate if additional adjustment is required, Tobit regression on ranks is a valid method. Its power, type-I error rate and accuracy were comparable to the classical Tobit regression. Conclusion: Non-normally distributed censored immunological data require appropriate statistical methods. Tobit regression on ranks meets these requirements and can be used for adjustment for covariates and potential confounding in large and complex immunological datasets.

Previous studies suggested potential priming effects of gestational weight gain (GWG) on offspring's body composition in later life. However, consistency of these effects in normal weight, overweight and obese mothers is less clear. We combined the individual data of three German cohorts and assessed associations of total and excessive GWG (as defined by criteria of the Institute of Medicine) with offspring's mean body mass index (BMI) standard deviation scores (SDS) and overweight at the age of 5-6 years (total: n = 6,254). Quantile regression was used to examine potentially different effects on different parts of the BMI SDS distribution. All models were adjusted for birth weight, maternal age and maternal smoking during pregnancy and stratified by maternal pre-pregnancy weight status. In adjusted models, positive associations of total and excessive GWG with mean BMI SDS and overweight were observed only in children of non- overweight mothers. For example, excessive GWG was associated with a mean increase of 0.08 (95% CI: 0.01, 0.15) units of BMI SDS (0.13 (0.02, 0.24) kg/m(2) of 'real' BMI) in children of normal-weight mothers. The effects of total and excessive GWG on BMI SDS increased for higher- BMI children of normal-weight mothers. Increased GWG is likely to be associated with overweight in offspring of non-overweight mothers.

Hyperuricemia is associated with an increased risk of metabolic and cardiovascular diseases. There are pronounced sex differences in the levels of uric acid. It is largely unknown whether or not reproductive parameters which induce hormonal changes are responsible for this. We examined if there are associations between reproductive parameters and uric acid levels in a female population-based sample. In this cross-sectional analysis, data of 1530 women aged 32 to 81 years participating in the KORA F4 study, conducted between 2006 and 2008 in Southern Germany were used. Reproductive parameters were obtained by standardized interviews. Uric acid levels were tested by the uricase method. The whole study sample and stratified in pre- and postmenopausal women was analyzed. Menopausal status and earlier age at menarche were associated with higher serum uric acid levels (age-adjusted: p-values 0.003,

Objective: To evaluate the diagnostic performance of two rapid detection tests (RDTs) for HIV 1/2 in plasma and in whole blood samples. Methods: More than 15,000 study subjects above the age of two years participated in two rounds of a cohort study to determine the prevalence of HIV. HIV testing was performed using the Determine HIV 1/2 test (Abbott) in the first (2006/2007) and the HIV 1/2 STAT-PAK Dipstick Assay (Chembio) in the second round (2007/2008) of the survey. Positive results were classified into faint and strong bands depending on the visual appearance of the test strip and confirmed by ELISA and Western blot. Results: The sensitivity and specificity of the Determine RDT were 100% (95% confidence interval = 86.8 to 100%) and 96.8% (95.9 to 97.6%) in whole blood and 100% (99.7 to 100%) and 97.9% (97.6 to 98.1%) in plasma respectively. Specificity was highly dependent on the tested sample type: when using whole blood, 67.1% of positive results were false positive, as opposed to 17.4% in plasma. Test strips with only faint positive bands were more often false positive than strips showing strong bands and were more common in whole blood than in plasma. Evaluation of the STAT-PAK RDT in plasma during the second year resulted in a sensitivity of 99.7% (99.1 to 99.9%) and a specificity of 99.3% (99.1 to 99.4%) with 6.9% of the positive results being false. Conclusions: Our study shows that the Determine HIV 1/2 strip test with its high sensitivity is an excellent tool to screen for HIV infection, but that – at least in our setting – it can not be recommended as a confirmatory test in VCT campaigns where whole blood is used.

All three nitric oxide synthase (NOS) isoforms are expressed in atherosclerotic plaques. NOS enzymes in general catalyse NO production. However, under conditions of substrate and cofactor deficiency, the enzyme directly catalyse superoxide formation. Considering this alternative chemistry, the effects of NOS on key events in spontaneous hyperlipidemia driven atherosclerosis have not been investigated yet. Here, we evaluate how endothelial nitric oxide synthase (eNOS) modulates leukocyte/endothelial- (L/E) and platelet/endothelial- (P/E) interactions in atherosclerosis and the production of nitric oxide (NO) and superoxide by the enzyme. Intravital microscopy (IVM) of carotid arteries revealed significantly increased L/E-interactions in apolipoproteinE/eNOS double knockout mice (apoE(-/-)/eNOS(-/-)), while P/E-interactions did not differ, compared to apoE(-/-). eNOS deficiency increased macrophage infiltration in carotid arteries and vascular cell adhesion molecule-1 (VCAM-1) expression, both in endothelial and smooth muscle cells. Despite the expression of other NOS isoforms (inducible NOS, iNOS and neuronal NOS, nNOS) in plaques, Electron Spin Resonance (ESR) measurements of NO showed significant contribution of eNOS to total circulating and vascular wall NO production. Pharmacological inhibition and genetic deletion of eNOS reduced vascular superoxide production, indicating uncoupling of the enzyme in apoE(-/-) vessels. Overt plaque formation, increased vascular inflammation and L/E- interactions are associated with significant reduction of superoxide production in apoE(-/-)/eNOS(-/-) vessels. Therefore, lack of eNOS does not cause an automatic increase in oxidative stress. Uncoupling of eNOS occurs in apoE(-/-) atherosclerosis but does not negate the enzyme's strong protective effects.

Low-carbohydrate, high-fat (LC-HF) diets are popular for inducing weight loss in overweighed adults. Adaptive thermogenesis increased by specific effects of macronutrients on energy expenditure has been postulated to induce this weight loss. We studied brown adipose tissue (BAT) morphology and function following exposure to different LC-HF diets. Methods: Male Wistar rats were fed a standard control diet ad libitum or pair-fed isoenergetic amounts of three experimental diets for 4 weeks. The diets had the following macronutrient composition (% metabolizable energy: carbohydrates, fat, protein): control (64.3/16.7/19), LC-HF-low protein (LC-HF-LP, 1.7/92.8/5.5), LC-HF-normal-protein (LC-HF-NP, 2.2/78.7/19.1), and a high fat diet with carbohydrates (“high fat”, 19.4/61.9/18.7). Results: Body weight gain was reduced in all pair-fed experimental groups as compared to rats fed the control diet, with more pronounced effect in rats on LC-HF diets than on the high fat diet with carbohydrates. High fat diets increased expression of PGC1α and ADRB3 in BAT indicating higher SNS outflow. However, UCP1 mRNA expression and expression of UCP1 assessed by immunohistochemistry was not different between diet groups. In accordance, analysis of mitochondrial function in-vitro by extracellular flux analyser (Seahorse Bioscience) and measurement of inducible thermogenesis in vivo (primary endpoint), explored by indirect calorimetry following norepinephrine injection, did not show significant differences between groups. Histology of BAT revealed increased lipid droplet size in rats fed the high-fat diet and both LC-HF diets. Conclusion: All experimental diets upregulated expression of genes which are indicative for increased BAT activity. However, the functional measurements in vivo revealed no increase of inducible BAT thermogenesis. This indicates that lower body weight gain with LC-HF diets and a high fat diet in a pair-feeding setting is not caused by increased adaptive thermogenesis in BAT.

We studied whether short-term exposure to air pollution was associated with non-specific abdominal pain in epidemiologic and animal studies. Patients visiting the emergency department with non-specific abdominal pain were identified in Edmonton (1992 to 2002, n = 95,173) and Montreal (1997 to 2002, n = 25,852). We calculated the daily concentrations for ozone (O(3)), nitrogen dioxide (NO(2)), sulfur dioxide (SO(2)), carbon monoxide (CO), and particles

IL12B encodes the p40 subunit of IL-12, which is also part of IL-23. Recent genome-wide association studies identified IL12B and IL23R as susceptibility genes for inflammatory bowel disease (IBD). However, the phenotypic effects and potential gene-gene interactions of IL12B variants are largely unknown

Motor dysfunction is a consistently reported but understudied aspect of schizophrenia. Postural sway area was examined in individuals with schizophrenia under four conditions with different amounts of visual and proprioceptive feedback: eyes open or closed and feet together or shoulder width apart. The nonlinear complexity of postural sway was assessed by detrended fluctuation analysis (DFA). The schizophrenia group (n = 27) exhibited greater sway area compared to controls (n = 37). Participants with schizophrenia showed increased sway area following the removal of visual input, while this pattern was absent in controls. Examination of DFA revealed decreased complexity of postural sway and abnormal changes in complexity upon removal of visual input in individuals with schizophrenia. Additionally, less complex postural sway was associated with increased symptom severity in participants with schizophrenia. Given the critical involvement of the cerebellum and related circuits in postural stability and sensorimotor integration, these results are consistent with growing evidence of motor, cerebellar, and sensory integration dysfunction in the disorder, and with theoretical models that implicate cerebellar deficits and more general disconnection of function in schizophrenia.

Xenograft mouse models represent helpful tools for preclinical studies on human tumors. For modeling the complexity of the human disease, primary tumor cells are by far superior to established cell lines. As qualified exemplary model, patients' acute lymphoblastic leukemia cells reliably engraft in mice inducing orthotopic disseminated leukemia closely resembling the disease in men. Unfortunately, disease monitoring of acute lymphoblastic leukemia in mice is hampered by lack of a suitable readout parameter.

We have investigated molecular mechanisms for muscle mass accretion in a non-inbred mouse model (DU6P mice) characterized by extreme muscle mass. This extreme muscle mass was developed during 138 generations of phenotype selection for high protein content. Due to the repeated trait selection a complex setting of different mechanisms was expected to be enriched during the selection experiment. In muscle from 29-week female DU6P mice we have identified robust increases of protein kinase B activation (AKT, Ser-473, up to 2-fold) if compared to 11- and 54-week DU6P mice or controls. While a number of accepted effectors of AKT activation, including IGF-I, IGF-II, insulin/IGF-receptor, myostatin or integrin-linked kinase (ILK), were not correlated with this increase, phosphatase and tensin homologue deleted on chromosome 10 (PTEN) was down-regulated in 29-week female DU6P mice. In addition, higher levels of PTEN phosphorylation were found identifying a second mechanism of PTEN inhibition. Inhibition of PTEN and activation of AKT correlated with specific activation of p70S6 kinase and ribosomal protein S6, reduced phosphorylation of eukaryotic initiation factor 2α (eIF2α) and higher rates of protein synthesis in 29-week female DU6P mice. On the other hand, AKT activation also translated into specific inactivation of glycogen synthase kinase 3ß (GSK3ß) and an increase of muscular glycogen. In muscles from 29-week female DU6P mice a significant increase of protein/DNA was identified, which was not due to a reduction of protein breakdown or to specific increases of translation initiation. Instead our data support the conclusion that a higher rate of protein translation is contributing to the higher muscle mass in mid-aged female DU6P mice. Our results further reveal coevolution of high protein and high glycogen content during the selection experiment and identify PTEN as gate keeper for muscle mass in mid-aged female DU6P mice.

Sleep enhances memory consolidation. Bearing in mind that food intake produces many metabolic signals that can influence memory processing in humans (e.g., insulin), the present study addressed the question as to whether the enhancing effect of sleep on memory consolidation is affected by the amount of energy consumed during the preceding daytime. Compared to sleep, nocturnal wakefulness has been shown to impair memory consolidation in humans. Thus, a second question was to examine whether the impaired memory consolidation associated with sleep deprivation (SD) could be compensated by increased daytime energy consumption. To these aims, 14 healthy normal-weight men learned a finger tapping sequence (procedural memory) and a list of semantically associated word pairs (declarative memory). After the learning period, standardized meals were administered, equaling either ∼50% or ∼150% of the estimated daily energy expenditure. In the morning, after sleep or wakefulness, memory consolidation was tested. Plasma glucose was measured both before learning and retrieval. Polysomnographic sleep recordings were performed by electroencephalography (EEG). Independent of energy intake, subjects recalled significantly more word pairs after sleep than they did after SD. When subjects stayed awake and received an energy oversupply, the number of correctly recalled finger sequences was equal to those seen after sleep. Plasma glucose did not differ among conditions, and sleep time in the sleep conditions was not influenced by the energy intake interventions. These data indicate that the daytime energy intake level affects neither sleep's capacity to boost the consolidation of declarative and procedural memories, nor sleep's quality. However, high energy intake was followed by an improved procedural but not declarative memory consolidation under conditions of SD. This suggests that the formation of procedural memory is not only triggered by sleep but is also sensitive to the fluctuations in the energy state of the body.

Treatment of acute lung injury (ALI) remains an unsolved problem in intensive care medicine. As simvastatin exerts protective effects in inflammatory diseases we explored its effects on development of ALI and due to the importance of neutrophils in ALI also on neutrophil effector functions. C57Bl/6 mice were exposed to aerosolized LPS (500 µg/ml) for 30 min. The count of alveolar, interstitial, and intravasal neutrophils were assessed 4 h later by flow cytometry. Lung permeability changes were assessed by FITC-dextran clearance and albumin content in the BAL fluid. In vitro, we analyzed the effect of simvastatin on neutrophil adhesion, degranulation, apoptosis, and formation of reactive oxygen species. To monitor effects of simvastatin on bacterial clearance we performed phagocytosis and bacterial killing studies in vitro as well as sepsis experiments in mice. Simvastatin treatment before and after onset of ALI reduces neutrophil influx into the lung as well as lung permeability indicating the protective role of simvastatin in ALI. Moreover, simvastatin reduces the formation of ROS species and adhesion of neutrophils without affecting apoptosis, bacterial phagocytosis and bacterial clearance. Simvastatin reduces recruitment and activation of neutrophils hereby protecting from LPS-induced ALI. Our results imply a potential role for statins in the management of ALI.

Injuries to the spinal cord often result in severe functional deficits that, in case of incomplete injuries, can be partially compensated by axonal remodeling. The corticospinal tract (CST), for example, responds to a thoracic transection with the formation of an intraspinal detour circuit. The key step for the formation of the detour circuit is the sprouting of new CST collaterals in the cervical spinal cord that contact local interneurons. How individual collaterals are formed and refined over time is incompletely understood.

The prevalence of Parkinson's disease (PD) increases with age. Up to 50% of PD show cognitive decline in terms of a mild cognitive impairment already in early stages that predict the development of dementia, which can occur in up to 80% of PD patients over the long term, called Parkinson's disease dementia (PDD). So far, diagnosis of PD/PDD is made according to clinical and neuropsychological examinations while laboratory data is only used for exclusion of other diseases. The aim of this study was the identification of possible biomarkers in cerebrospinal fluid (CSF) of PD, PDD and controls (CON) which predict the development of dementia in PD. For this, a proteomic approach optimized for CSF was performed using 18 clinically well characterized patients in a first step with subsequent validation using 84 patients. Here, we detected differentially sialylated isoforms of Serpin A1 as marker for differentiation of PD versus PDD in CSF. Performing 2D-immunoblots, all PDD patients could be identified correctly (sensitivity 100%). Ten out of 24 PD patients showed Serpin A1 isoforms in a similar pattern like PDD, indicating a specificity of 58% for the test-procedure. In control samples, no additional isoform was detected. On the basis of these results, we conclude that differentially sialylated products of Serpin A1 are an interesting biomarker to indicate the development of a dementia during the course of PD.

Tissue-specific transcripts are likely to be of importance for the corresponding organ. While attempting to define the specific transcriptome of the human lung, we identified the transcript of a yet uncharacterized protein, SFTA2. In silico analyses, biochemical methods, fluorescence imaging and animal challenge experiments were employed to characterize SFTA2. Human SFTA2 is located on Chr. 6p21.33, a disease-susceptibility locus for diffuse panbronchiolitis. RT-PCR verified the abundance of SFTA2-specific transcripts in human and mouse lung. SFTA2 is synthesized as a hydrophilic precursor releasing a 59 amino acid mature peptide after cleavage of an N-terminal secretory signal. SFTA2 has no recognizable homology to other proteins while orthologues are present in all mammals. SFTA2 is a glycosylated protein and specifically expressed in nonciliated bronchiolar epithelium and type II pneumocytes. In accordance with other hydrophilic surfactant proteins, SFTA2 did not colocalize with lamellar bodies but colocalized with golgin97 and clathrin-labelled vesicles, suggesting a classical secretory pathway for its expression and secretion. In the mouse lung, Sfta2 was significantly downregulated after induction of an inflammatory reaction by intratracheal lipopolysaccharides paralleling surfactant proteins B and C but not D. Hyperoxia, however, did not alter SFTA2 mRNA levels. We have characterized SFTA2 and present it as a novel unique secretory peptide highly expressed in the lung.

In the present study the relationship between behavioural adjustment following cognitive conflict and schizotypy was investigated using a Stroop colour naming paradigm. Previous research has found deficits with behavioural adjustment in schizophrenia patients. Based on these findings, we hypothesized that individual differences in schizotypy, a personality trait reflecting the subclinical expression of the schizophrenia phenotype, would be associated with behavioural adjustment. Additionally, we investigated whether such a relationship would be explained by individual differences in neuroticism, a non-specific measure of negative trait emotionality known to be correlated with schizotypy. 106 healthy volunteers (mean age: 25.1, 60% females) took part. Post-conflict adjustment was measured in a computer-based version of the Stroop paradigm. Schizotypy was assessed using the Schizotypal Personality Questionnaire (SPQ) and Neuroticism using the NEO-FFI. We found a negative correlation between schizotypy and post-conflict adjustment (r = -.30, p

The goal of the present study was to determine whether treatment with cigarette smoke extract (CSE) induces cell loss, cellular senescence, and extracellular matrix (ECM) synthesis in primary human retinal pigment epithelial (RPE) cells. Primary cultured human RPE cells were exposed to 2, 4, 8, and 12% of CSE concentration for 24 hours. Cell loss was detected by cell viability assay. Lipid peroxidation was assessed by loss of cis-parinaric acid (PNA) fluorescence. Senescence-associated ß-galactosidase (SA-ß-Gal) activity was detected by histochemical staining. Expression of apolipoprotein J (Apo J), connective tissue growth factor (CTGF), fibronectin, and laminin were examined by real-time PCR, western blot, or ELISA experiments. The results showed that exposure of cells to 12% of CSE concentration induced cell death, while treatment of cells with 2, 4, and 8% CSE increased lipid peroxidation. Exposure to 8% of CSE markedly increased the number of SA-ß-Gal positive cells to up to 82%, and the mRNA expression of Apo J, CTGF, and fibronectin by approximately 3-4 fold. Treatment with 8% of CSE also increased the protein expression of Apo J and CTGF and the secretion of fibronectin and laminin. Thus, treatment with CSE can induce cell loss, senescent changes, and ECM synthesis in primary human RPE cells. It may be speculated that cigarette smoke could be involved in cellular events in RPE cells as seen in age-related macular degeneration.

Krüppel-like factor 8 (KLF8) has only recently been identified to be involved in tumor cell proliferation and invasion of several different tumor entities like renal cell carcinoma, hepatocellular carcinoma and breast cancer. In the present study, we show for the first time the expression of KLF8 in gliomas of different WHO grades and its functional impact on glioma cell proliferation. In order to get information about KLF8-mRNA regulation qPCR was performed and did not reveal any significant difference in samples (n = 10 each) of non-neoplastic brain (NNB), low-grade gliomas (LGG, WHO°II) and glioblastomas (GBM, WHO°IV). Immunohistochemistry of tissue samples (n = 7 LGG, 11 AA and 12 GBM) did not show any significant difference in the fraction of KLF8-immunopositive cells of all analyzed cells in LGG (87%), AA (80%) or GBM (89%). Tissue samples from cerebral breast cancer metastasis, meningiomas but also non-neoplastic brain demonstrated comparable relative cell counts as well. Moreover, there was no correlation between KLF8 expression and the expression pattern of the assumed proliferation marker Ki67, which showed high variability between different tumor grade (9% (LGG), 6% (AA) and 15% (GBM) of Ki67-immunopositive cells). Densitometric analysis of Western blotting revealed that the relative amount of KLF8-protein did also not differ between the highly aggressive and proliferative GBM (1.05) compared to LGG (0.93; p

Thus, we evaluated the immunofluorescence pattern of TRAIL-receptors and E-cadherin to assess the fraction of membrane-bound TRAIL-receptors in 231 selected patients with early-stage CRC undergoing surgical treatment only. Moreover, we investigated whether membrane staining for TRAIL-receptors as well as the presence of KRAS mutations or of microsatellite instability (MSI) had an effect on survival and thus a prognostic effect. The fact that the receptors for the TNF-related apoptosis inducing ligand (TRAIL) are almost invariably expressed in colorectal cancer (CRC) represents the rationale for the employment of TRAIL-receptors targeting compounds for the therapy of patients affected by this tumor. Yet, first reports on the use of these bioactive agents provided disappointing results. We therefore hypothesized that loss of membrane-bound TRAIL-R might be a feature of some CRC and that the evaluation of membrane staining rather than that of the overall expression of TRAIL-R might predict the response to TRAIL-R targeting compounds in this tumor. As expected, almost all CRC samples stained positive for TRAIL-R1 and 2. Instead, membrane staining for these receptors was positive in only 71% and 16% of samples respectively. No correlation between KRAS mutation status or MSI-phenotype and prognosis could be detected. TRAIL-R1 staining intensity correlated with survival in univariate analysis, but only membranous staining of TRAIL-R1 and TRAIL-R2 on cell membranes was an independent predictor of survival (cox multivariate analysis: TRAIL-R1: p = 0.019, RR 2.06[1.12-3.77]; TRAIL-R2: p = 0.033, RR 3.63[1.11-11.84]). In contrast to the current assumptions, loss of membrane staining for TRAIL-receptors is a common feature of early stage CRC which supersedes the prognostic significance of their staining intensity. Failure to achieve therapeutic effects in recent clinical trials using TRAIL-receptors targeting compounds might be due to insufficient selection of patients bearing tumors with membrane-bound TRAIL-receptors.

The transcription factor HNF1B, encoded by the TCF2 gene, plays an important role in the organogenesis of vertebrates. In humans, heterozygous mutations of HNF1B are associated with several diseases, such as pancreatic β-cell dysfunction leading to maturity-onset diabetes of the young (MODY5), defective kidney development, disturbed liver function, pancreas atrophy, and malformations of the genital tract. The African claw frog Xenopus laevis is an excellent model to study the processes involved in embryogenesis and organogenesis, as it can be manipulated easily with a series of methods. In the present study, we overexpressed HNF1β mutants in the developing Xenopus embryo to assess their roles during organogenesis, particularly in the developing pronephric kidney. Towards this goal, we developed a heat-shock inducible binary Cre/loxP system with activator and effector strains. Heat-shock activation of the mutant HNF1B variants P328L329del and A263insGG resulted in malformations of various organs and the affected larvae developed large edemas. Defects in the pronephros were primarily confined to malformed proximal tubules. Furthermore, the expression of the proximal tubule marker genes tmem27 and slc3a1, both involved in amino acid transport, was affected. Both P328L329del and A263insGG downregulated expression of slc3a1. In addition, P328L329del reduced tmem27 expression while A263insGG overexpression decreased expression of the chloride channel clcnk and the transcription factor pax2. Overexpression of two mutant HNF1B derivatives resulted in distinct phenotypes reflected by either a reduction or an enlargement of pronephros size. The expression of selected pronephric marker genes was differentially affected upon overexpression of HNF1B mutations. Based on our findings, we postulate that HNF1B mutations influence gene regulation upon overexpression in specific and distinct manners. Furthermore, our study demonstrates that the newly established Cre/loxP system for Xenopus embryos is an attractive alternative to examine the gene regulatory potential of transcription factors in developing pronephric kidney as exemplified here for HNF1B.

Red blood cell (RBC) n-3 fatty acid status is related to various health outcomes. Accepted biological markers for the fatty acid status determination are RBC phospholipids, phosphatidylcholine, and phosphatidyletholamine. The analysis of these lipid fractions is demanding and time consuming and total phospholipid n-3 fatty acid levels might be affected by changes of sphingomyelin contents in the RBC membrane during n-3 supplementation. We developed a method for the specific analysis of RBC glycerophospholipids. The application of the new method in a DHA supplementation trial and the comparison to established markers will determine the relevance of RBC GPL as a valid fatty acid status marker in humans. Methyl esters of glycerophospholipid fatty acids are selectively generated by a two step procedure involving methanolic protein precipitation and base-catalysed methyl ester synthesis. RBC GPL solubilisation is facilitated by ultrasound treatment. Fatty acid status in RBC glycerophospholipids and other established markers were evaluated in thirteen subjects participating in a 30 days supplementation trial (510 mg DHA/d). The intra-assay CV for GPL fatty acids ranged from 1.0 to 10.5% and the inter-assay CV from 1.3 to 10.9%. Docosahexaenoic acid supplementation significantly increased the docosahexaenoic acid contents in all analysed lipid fractions. High correlations were observed for most of the mono- and polyunsaturated fatty acids, and for the omega-3 index (r = 0.924) between RBC phospholipids and glycerophospholipids. The analysis of RBC glycerophospholipid fatty acids yields faster, easier and less costly results equivalent to the conventional analysis of RBC total phospholipids.

Betahistine is a histamine H(1)-receptor agonist and H(3)-receptor antagonist that is administered to treat Menière's disease. Despite widespread use, its pharmacological mode of action has not been entirely elucidated. This study investigated the effect of betahistine on guinea pigs at dosages corresponding to clinically used doses for cochlear microcirculation. Thirty healthy Dunkin-Hartley guinea pigs were randomly assigned to five groups to receive betahistine dihydrochloride in a dose of 1,000 mg/kg b. w. (milligram per kilogram body weight), 0.100 mg/kg b. w., 0.010 mg/kg b. w., 0.001 mg/kg b. w. in NaCl 0.9% or NaCl 0.9% alone as placebo. Cochlear blood flow and mean arterial pressure were continuously monitored by intravital fluorescence microscopy and invasive blood pressure measurements 3 minutes before and 15 minutes after administration of betahistine. When betahistine was administered in a dose of 1.000 mg/kg b. w. cochlear blood flow was increased to a peak value of 1.340 arbitrary units (SD: 0.246; range: 0.933-1.546 arb. units) compared to baseline (p

Synucleinopathies such as Parkinson's disease, multiple system atrophy and dementia with Lewy bodies are characterized by deposition of aggregated α-synuclein. Recent findings indicate that pathological oligomers rather than fibrillar aggregates may represent the main toxic protein species. It has been shown that α-synuclein oligomers can increase the conductance of lipid bilayers and, in cell-culture, lead to calcium dyshomeostasis and cell death. In this study, employing a setup for single-channel electrophysiology, we found that addition of iron-induced α-synuclein oligomers resulted in quantized and stepwise increases in bilayer conductance indicating insertion of distinct transmembrane pores. These pores switched between open and closed states depending on clamped voltage revealing a single-pore conductance comparable to that of bacterial porins. Pore conductance was dependent on transmembrane potential and the available cation. The pores stably inserted into the bilayer and could not be removed by buffer exchange. Pore formation could be inhibited by co-incubation with the aggregation inhibitor baicalein. Our findings indicate that iron-induced α-synuclein oligomers can form a uniform and distinct pore species with characteristic electrophysiological properties. Pore formation could be a critical event in the pathogenesis of synucleinopathies and provide a novel structural target for disease-modifying therapy.

A large fraction of murine tumors induced by transgenic expression of SV40 large T antigen (SV40 TAg) exhibits a neuroendocrine phenotype. It is unclear whether SV40 TAg induces the neuroendocrine phenotype by preferential transformation of progenitor cells committed to the neuroendocrine lineage or by transcriptional activation of neuroendocrine genes. To address this question we analyzed CEA424-SV40 TAg-transgenic mice that develop spontaneous tumors in the antral stomach region. Immunohistology revealed expression of the neuroendocrine marker chromogranin A in tumor cells. By ELISA an 18-fold higher level of serotonin could be detected in the blood of tumor-bearing mice in comparison to nontransgenic littermates. Transcriptome analyses of antral tumors combined with gene set enrichment analysis showed significant enrichment of genes considered relevant for human neuroendocrine tumor biology. This neuroendocrine gene signature was also expressed in 424GC, a cell line derived from a CEA424-SV40 TAg tumor, indicating that the tumor cells exhibit a similar neuroendocrine phenotype also in vitro. Treatment of 424GC cells with SV40 TAg-specific siRNA downregulated expression of the neuroendocrine gene signature. SV40 TAg thus appears to directly induce a neuroendocrine gene signature in gastric carcinomas of CEA424-SV40 TAg-transgenic mice. This might explain the high incidence of neuroendocrine tumors in other murine SV40 TAg tumor models. Since the oncogenic effect of SV40 TAg is caused by inactivation of the tumor suppressor proteins p53 and RB1 and loss of function of these proteins is commonly observed in human neuroendocrine tumors, a similar mechanism might cause neuroendocrine phenotypes in human tumors.

Creatine has been shown to be neuroprotective in aging, neurodegenerative conditions and brain injury. As a common molecular background, oxidative stress and disturbed cellular energy homeostasis are key aspects in these conditions. Moreover, in a recent report we could demonstrate a life-enhancing and health-promoting potential of creatine in rodents, mainly due to its neuroprotective action. In order to investigate the underlying pharmacology mediating these mainly neuroprotective properties of creatine, cultured primary embryonal hippocampal and cortical cells were challenged with glutamate or H(2)O(2). In good agreement with our in vivo data, creatine mediated a direct effect on the bioenergetic balance, leading to an enhanced cellular energy charge, thereby acting as a neuroprotectant. Moreover, creatine effectively antagonized the H(2)O(2)-induced ATP depletion and the excitotoxic response towards glutamate, while not directly acting as an antioxidant. Additionally, creatine mediated a direct inhibitory action on the NMDA receptor-mediated calcium response, which initiates the excitotoxic cascade. Even excessive concentrations of creatine had no neurotoxic effects, so that high-dose creatine supplementation as a health-promoting agent in specific pathological situations or as a primary prophylactic compound in risk populations seems feasible. In conclusion, we were able to demonstrate that the protective potential of creatine was primarily mediated by its impact on cellular energy metabolism and NMDA receptor function, along with reduced glutamate spillover, oxidative stress and subsequent excitotoxicity.

Melanoma is an often fatal form of skin cancer which is remarkably resistant against radio- and chemotherapy. Even new strategies that target RAS/RAF signaling and display unprecedented efficacy are characterized by resistance mechanisms. The targeting of survival pathways would be an attractive alternative strategy, if tumor-specific cell death can be achieved. Bcl-2 proteins play a central role in regulating survival of tumor cells. In this study, we systematically investigated the relevance of antiapoptotic Bcl-2 proteins, i.e., Bcl-2, Bcl-xL, Bcl-w, Mcl-1, and A1, in melanoma cell lines and non-malignant cells using RNAi. We found that melanoma cells required the presence of specific antiapoptotic Bcl-2 proteins: Inhibition of Mcl-1 and A1 strongly induced cell death in some melanoma cell lines, whereas non-malignant cells, i.e., primary human fibroblasts or keratinocytes were not affected. This specific sensitivity of melanoma cells was further enhanced by the combined inhibition of Mcl-1 and A1 and resulted in 60% to 80% cell death in all melanoma cell lines tested. This treatment was successfully combined with chemotherapy, which killed a substantial proportion of cells that survived Mcl-1 and A1 inhibition. Together, these results identify antiapoptotic proteins on which specifically melanoma cells rely on and, thus, provide a basis for the development of new Bcl-2 protein-targeting therapies.

Recent findings in neuroscience suggest an overlap between brain regions involved in the execution of movement and perception of another's movement. This so-called "action-perception coupling" is supposed to serve our ability to automatically infer the goals and intentions of others by internal simulation of their actions. A consequence of this coupling is motor interference (MI), the effect of movement observation on the trajectory of one's own movement. Previous studies emphasized that various features of the observed agent determine the degree of MI, but could not clarify how human-like an agent has to be for its movements to elicit MI and, more importantly, what 'human-like' means in the context of MI. Thus, we investigated in several experiments how different aspects of appearance and motility of the observed agent influence motor interference (MI). Participants performed arm movements in horizontal and vertical directions while observing videos of a human, a humanoid robot, or an industrial robot arm with either artificial (industrial) or human-like joint configurations. Our results show that, given a human-like joint configuration, MI was elicited by observing arm movements of both humanoid and industrial robots. However, if the joint configuration of the robot did not resemble that of the human arm, MI could longer be demonstrated. Our findings present evidence for the importance of human-like joint configuration rather than other human-like features for perception-action coupling when observing inanimate agents.

Analysis of the paired i.e. matching TCR α- and β-chain rearrangements of single human T cells is required for a precise investigation of clonal diversity, tissue distribution and specificity of protective and pathologic T-cell mediated immune responses. Here we describe a multiplex RT-PCR based technology, which for the first time allows for an unbiased analysis of the complete sequences of both α- and β-chains of TCR from single T cells. We validated our technology by the analysis of the pathologic T-cell infiltrates from tissue lesions of two T-cell mediated autoimmune diseases, psoriasis vulgaris (PV) and multiple sclerosis (MS). In both disorders we could detect various T cell clones as defined by multiple T cells with identical α- and β-chain rearrangements distributed across the tissue lesions. In PV, single cell TCR analysis of lesional T cells identified clonal CD8(+) T cell expansions that predominated in the epidermis of psoriatic plaques. An MS brain lesion contained two dominant CD8(+) T-cell clones that extended over the white and grey matter and meninges. In both diseases several clonally expanded T cells carried dual TCRs composed of one Vβ and two different Vα-chain rearrangements. These results show that our technology is an efficient instrument to analyse αβ-T cell responses with single cell resolution in man. It should facilitate essential new insights into the mechanisms of protective and pathologic immunity in many human T-cell mediated conditions and allow for resurrecting functional TCRs from any αβ-T cell of choice that can be used for investigating their specificity.

In addition to forming the epithelial barrier against the outside environment keratinocytes are immunologically active cells. In the treatment of severely burned skin, cryoconserved keratinocyte allografts gain in importance. It has been proposed that these allografts accelerate wound healing also due to the expression of a favourable--keratinocyte-derived--cytokine and growth factor milieu. In this study the morphology and cytokine expression profile of keratinocytes from skin after acute burn injury was compared to non-burned skin. Skin samples were obtained from patients after severe burn injury and healthy controls. Cells were cultured and secretion of selected inflammatory mediators was quantified using Bioplex Immunoassays. Immunohistochemistry was performed to analyse further functional and morphologic parameters. Histology revealed increased terminal differentiation of keratinocytes (CK10, CK11) in allografts from non-burned skin compared to a higher portion of proliferative cells (CK5, vimentin) in acute burn injury. Increased levels of IL-1α, IL-2, IL-4, IL-10, IFN-γ and TNFα could be detected in culture media of burn injury skin cultures. Both culture groups contained large amounts of IL-1RA. IL-6 and GM-CSF were increased during the first 15 days of culture of burned skin compared to control skin. Levels of VEGF, FGF-basic, TGF-ß und G-CSF were high in both but not significantly different. Cryoconservation led to a diminished mediator synthesis except for higher levels of intracellular IL-1α and IL-1ß. Skin allografts from non-burned skin show a different secretion pattern of keratinocyte-derived cytokines and inflammatory mediators compared to keratinocytes after burn injury. As these secreted molecules exert auto- and paracrine effects and subsequently contribute to healing and barrier restoration after acute burn injury therapies affecting this specific cytokine/growth factor micromilieu could be beneficial in burned patients.

Several barriers have to be overcome in order to achieve gene expression in target cells, e.g. cellular uptake, endosomal release and translocation to the nucleus. Nuclear localization sequences (NLS) enhance gene delivery by increasing the uptake of plasmid DNA (pDNA) to the nucleus. So far, only monopartite NLS were analysed for non-viral gene delivery. In this study, we examined the characteristics of a novel bipartite NLS like construct, namely NLS Ku70. We synthesized a dimeric structure of a modified NLS from the Ku70 protein (Ku70(2)-NLS), a nuclear transport active mutant of Ku70(2)-NLS (s1Ku70(2)-NLS) and a nuclear transport deficient mutant of Ku70(2)-NLS (s2Ku70(2)). We examined the transfection efficiency of binary Ku70(2)-NLS/DNA and ternary Ku70(2)-NLS/PEI/DNA gene vector complexes in vitro by using standard transfection protocols as well as the magnetofection method. The application of Ku70(2)-NLS and s1Ku70(2)-NLS increased gene transfer efficiency in vitro and in vivo. This study shows for the first time that the use of bipartite NLS compounds alone or in combination with cationic polymers is a promising strategy to enhance the efficiency of non-viral gene transfer.

The angiotensin converting enzyme (ACE) has been repeatedly discussed as susceptibility factor for major depression (MD) and the bi-directional relation between MD and cardiovascular disorders (CVD). In this context, functional polymorphisms of the ACE gene have been linked to depression, to antidepressant treatment response, to ACE serum concentrations, as well as to hypertension, myocardial infarction and CVD risk markers. The mostly investigated ACE Ins/Del polymorphism accounts for ~40%-50% of the ACE serum concentration variance, the remaining half is probably determined by other genetic, environmental or epigenetic factors, but these are poorly understood. The main aim of the present study was the analysis of the DNA methylation pattern in the regulatory region of the ACE gene in peripheral leukocytes of 81 MD patients and 81 healthy controls. We detected intensive DNA methylation within a recently described, functional important region of the ACE gene promoter including hypermethylation in depressed patients (p = 0.008) and a significant inverse correlation between the ACE serum concentration and ACE promoter methylation frequency in the total sample (p = 0.02). Furthermore, a significant inverse correlation between the concentrations of the inflammatory CVD risk markers ICAM-1, E-selectin and P-selectin and the degree of ACE promoter methylation in MD patients could be demonstrated (p = 0.01 - 0.04). The results of the present study suggest that aberrations in ACE promoter DNA methylation may be an underlying cause of MD and probably a common pathogenic factor for the bi-directional relationship between MD and cardiovascular disorders.

Two-component signaling systems are widespread in bacteria, but also found in fungi. In this study, we have characterized TcsC, the only Group III two-component sensor kinase of Aspergillus fumigatus. TcsC is required for growth under hyperosmotic stress, but dispensable for normal growth, sporulation and conidial viability. A characteristic feature of the ΔtcsC mutant is its resistance to certain fungicides, like fludioxonil. Both hyperosmotic stress and treatment with fludioxonil result in a TcsC-dependent phosphorylation of SakA, the final MAP kinase in the high osmolarity glycerol (HOG) pathway, confirming a role for TcsC in this signaling pathway. In wild type cells fludioxonil induces a TcsC-dependent swelling and a complete, but reversible block of growth and cytokinesis. Several types of stress, such as hypoxia, exposure to farnesol or elevated concentrations of certain divalent cations, trigger a differentiation in A. fumigatus toward a "fluffy" growth phenotype resulting in white, dome-shaped colonies. The ΔtcsC mutant is clearly more susceptible to these morphogenetic changes suggesting that TcsC normally antagonizes this process. Although TcsC plays a role in the adaptation of A. fumigatus to hypoxia, it seems to be dispensable for virulence.

Enteric pathogens need to grow efficiently in the gut lumen in order to cause disease and ensure transmission. The interior of the gut forms a complex environment comprising the mucosal surface area and the inner gut lumen with epithelial cell debris and food particles. Recruitment of neutrophils to the intestinal lumen is a hallmark of non-typhoidal Salmonella enterica infections in humans. Here, we analyzed the interaction of gut luminal neutrophils with S. enterica serovar Typhimurium (S. Tm) in a mouse colitis model.Upon S. Tm(wt) infection, neutrophils transmigrate across the mucosa into the intestinal lumen. We detected a majority of pathogens associated with luminal neutrophils 20 hours after infection. Neutrophils are viable and actively engulf S. Tm, as demonstrated by live microscopy. Using S. Tm mutant strains defective in tissue invasion we show that pathogens are mostly taken up in the gut lumen at the epithelial barrier by luminal neutrophils. In these luminal neutrophils, S. Tm induces expression of genes typically required for its intracellular lifestyle such as siderophore production iroBCDE and the Salmonella pathogenicity island 2 encoded type three secretion system (TTSS-2). This shows that S. Tm at least transiently survives and responds to engulfment by gut luminal neutrophils. Gentamicin protection experiments suggest that the life-span of luminal neutrophils is limited and that S. Tm is subsequently released into the gut lumen. This "fast cycling" through the intracellular compartment of gut luminal neutrophils would explain the high fraction of TTSS-2 and iroBCDE expressing intra- and extracellular bacteria in the lumen of the infected gut. In conclusion, live neutrophils recruited during acute S. Tm colitis engulf pathogens in the gut lumen and may thus actively engage in shaping the environment of pathogens and commensals in the inflamed gut.

We previously investigated a sample of patients during an active phase of psychosis in the search for genetic predictors of haloperidol induced side effects. In the present work we extend the genetic association analysis to a wider panel of genetic variations, including 508 variations located in 96 genes. The original sample included 96 patients. An independent group of 357 patients from the CATIE study served as a replication sample. Outcomes in the investigation sample were the variation through time of: 1) the ESRS and UKU total scores 2) ESRS and UKU subscales (neurologic and psychic were included) related to tremors and 3) ESRS and UKU subscales that do not relate to tremors. Outcome in the replication sample was the presence vs absence of motoric side effects from baseline to visit 1 (~ one month of treatment) as assessed by the AIMS scale test. Rs2242480 located in the CYP3A4 was associated with a different distribution of the UKU neurologic scores through time (permutated p = 0.047) along with a trend for a different haloperidol plasma levels (lower in CC subjects). This finding was not replicated in the CATIE sample. In conclusion, we did not find conclusive evidence for a major association between the investigated variations and haloperidol induced motoric side effects.

Patients with phenylketonuria (PKU) have to follow a lifelong phenylalanine restricted diet. This type of diet markedly reduces the intake of saturated and unsaturated fatty acids especially long chain polyunsaturated fatty acids (LC-PUFA). Long-chain saturated fatty acids are substrates of mitochondrial fatty acid oxidation for acetyl-CoA production. LC-PUFA are discussed to affect inflammatory and haemostaseological processes in health and disease. The influence of the long term PKU diet on fatty acid metabolism with a special focus on platelet eicosanoid metabolism has been investigated in the study presented here. 12 children with PKU under good metabolic control and 8 healthy controls were included. Activated fatty acids (acylcarnitines C6-C18) in dried blood and the cholesterol metabolism in serum were analyzed by liquid chromatographic tandem mass spectrometry (LC-MS/MS). Fatty acid composition of plasma glycerophospholipids was determined by gas chromatography. LC-PUFA metabolites were analyzed in supernatants by LC-MS/MS before and after platelet activation and aggregation using a standardized protocol. Patients with PKU had significantly lower free carnitine and lower activated fatty acids in dried blood compared to controls. Phytosterols as marker of cholesterol (re-) absorption were not influenced by the dietary fatty acid restriction. Fatty acid composition in glycerophospholipids was comparable to that of healthy controls. However, patients with PKU showed significantly increased concentrations of y-linolenic acid (C18:3n-6) a precursor of arachidonic acid. In the PKU patients significantly higher platelet counts were observed. After activation with collagen platelet aggregation and thromboxane B(2) and thromboxane B(3) release did not differ from that of healthy controls. Long-term dietary fatty acid restriction influenced the intermediates of mitochondrial beta-oxidation. No functional influence on unsaturated fatty acid metabolism and platelet aggregation in patients with PKU was detected.

Fluorescent tagging of viral particles by genetic means enables the study of virus dynamics in living cells. However, the study of beta-herpesvirus entry and morphogenesis by this method is currently limited. This is due to the lack of replication competent, capsid-tagged fluorescent viruses. Here, we report on viable recombinant MCMVs carrying ectopic insertions of the small capsid protein (SCP) fused to fluorescent proteins (FPs). The FPs were inserted into an internal position which allowed the production of viable, fluorescently labeled cytomegaloviruses, which replicated with wild type kinetics in cell culture. Fluorescent particles were readily detectable by several methods. Moreover, in a spread assay, labeled capsids accumulated around the nucleus of the newly infected cells without any detectable viral gene expression suggesting normal entry and particle trafficking. These recombinants were used to record particle dynamics by live-cell microscopy during MCMV egress with high spatial as well as temporal resolution. From the resulting tracks we obtained not only mean track velocities but also their mean square displacements and diffusion coefficients. With this key information, we were able to describe particle behavior at high detail and discriminate between particle tracks exhibiting directed movement and tracks in which particles exhibited free or anomalous diffusion.

Genome-wide association studies identified PTPN2 (protein tyrosine phosphatase, non-receptor type 2) as susceptibility gene for inflammatory bowel diseases (IBD). However, the exact role of PTPN2 in Crohn's disease (CD) and ulcerative colitis (UC) and its phenotypic effect are unclear. We therefore performed a detailed genotype-phenotype and epistasis analysis of PTPN2 gene variants. Genomic DNA from 2131 individuals of Caucasian origin (905 patients with CD, 318 patients with UC, and 908 healthy, unrelated controls) was analyzed for two SNPs in the PTPN2 region (rs2542151, rs7234029) for which associations with IBD were found in previous studies in other cohorts. Our analysis revealed a significant association of PTPN2 SNP rs2542151 with both susceptibility to CD (p = 1.95×10⁻⁵; OR 1.49 [1.34-1.79]) and UC (p = 3.87×10⁻², OR 1.31 [1.02-1.68]). Moreover, PTPN2 SNP rs7234029 demonstrated a significant association with susceptibility to CD (p = 1.30×10⁻³; OR 1.35 [1.13-1.62]) and a trend towards association with UC (p = 7.53×10⁻²; OR 1.26 [0.98-1.62]). Genotype-phenotype analysis revealed an association of PTPN2 SNP rs7234029 with a stricturing disease phenotype (B2) in CD patients (p = 6.62×10⁻³). Epistasis analysis showed weak epistasis between the ATG16L1 SNP rs2241879 and PTPN2 SNP rs2542151 (p = 0.024) in CD and between ATG16L1 SNP rs4663396 and PTPN2 SNP rs7234029 (p = 4.68×10⁻³) in UC. There was no evidence of epistasis between PTPN2 and NOD2 and PTPN2 and IL23R. In silico analysis revealed that the SNP rs7234029 modulates potentially the binding sites of several transcription factors involved in inflammation including GATA-3, NF-κB, C/EBP, and E4BP4. Our data confirm the association of PTPN2 variants with susceptibility to both CD and UC, suggesting a common disease pathomechanism for these diseases. Given recent evidence that PTPN2 regulates autophagosome formation in intestinal epithelial cells, the potential link between PTPN2 and ATG16L1 should be further investigated.

Genetics of the variability of normal and diseased brain structure largely remains to be elucidated. Expansions of certain trinucleotide repeats cause neurodegenerative disorders of which Huntington's disease constitutes the most common example. Here, we test the hypothesis that variation within the IT15 gene on chromosome 4, whose expansion causes Huntington's disease, influences normal human brain structure. In 278 normal subjects, we determined CAG repeat length within the IT15 gene on chromosome 4 and analyzed high-resolution T1-weighted magnetic resonance images by the use of voxel-based morphometry. We found an increase of GM with increasing long CAG repeat and its interaction with age within the pallidum, which is involved in Huntington's disease. Our study demonstrates that a certain trinucleotide repeat influences normal brain structure in humans. This result may have important implications for the understanding of both the healthy and diseased brain.

The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.

The E4 allele of the ApoE gene has consistently been shown to be related to an increased risk of Alzheimer's disease (AD). The E4 allele is also associated with functional and structural grey matter (GM) changes in healthy young, middle-aged and older subjects. Here, we assess volumes of deep grey matter structures of 22 healthy younger ApoE4 carriers and 22 non-carriers (20-38 years). Volumes of the nucleus accumbens, amygdala, caudate nucleus, hippocampus, pallidum, putamen, thalamus and brain stem were calculated by FMRIB's Integrated Registration and Segmentation Tool (FIRST) algorithm. A significant drop in volume was found in the right hippocampus of ApoE4 carriers (ApoE4+) relative to non-carriers (ApoE4-), while there was a borderline significant decrease in the volume of the left hippocampus of ApoE4 carriers. The volumes of no other structures were found to be significantly affected by genotype. Atrophy has been found to be a sensitive marker of neurodegenerative changes, and our results show that within a healthy young population, the presence of the ApoE4+ carrier gene leads to volume reduction in a structure that is vitally important for memory formation. Our results suggest that the hippocampus may be particularly vulnerable to further degeneration in ApoE4 carriers as they enter middle and old age. Although volume reductions were noted bilaterally in the hippocampus, atrophy was more pronounced in the right hippocampus. This finding relates to previous work which has noted a compensatory increase in right hemisphere activity in ApoE4 carriers in response to preclinical declines in memory function. Possession of the ApoE4 allele may lead to greater predilection for right hemisphere atrophy even in healthy young subjects in their twenties.

Integrating non-viral vectors based on transposable elements are widely used for genetically engineering mammalian cells in functional genomics and therapeutic gene transfer. For the Sleeping Beauty (SB) transposase system it was demonstrated that convergent transcription driven by the SB transposase inverted repeats (IRs) in eukaryotic cells occurs after somatic integration. This could lead to formation of double-stranded RNAs potentially presenting targets for the RNA interference (RNAi) machinery and subsequently resulting into silencing of the transgene. Therefore, we aimed at investigating transgene expression upon transposition under RNA interference knockdown conditions. To establish RNAi knockdown cell lines we took advantage of the P19 protein, which is derived from the tomato bushy stunt virus. P19 binds and inhibits 21 nucleotides long, small-interfering RNAs and was shown to sufficiently suppress RNAi. We found that transgene expression upon SB mediated transposition was enhanced, resulting into a 3.2-fold increased amount of colony forming units (CFU) after transposition. In contrast, if the transgene cassette is insulated from the influence of chromosomal position effects by the chicken-derived cHS4 insulating sequences or when applying the Forg Prince transposon system, that displays only negligible transcriptional activity, similar numbers of CFUs were obtained. In summary, we provide evidence for the first time that after somatic integration transposon derived transgene expression is regulated by the endogenous RNAi machinery. In the future this finding will help to further improve the molecular design of the SB transposase vector system.