POPULARITY
Quadrise PLC CEO Jason Miles joins Proactive's Stephen Gunnion with an update on the significant advancements the company is making in biofuel technology. Quadrise's successful completion of a fuel trial in Morocco stands as a notable achievement, demonstrating the potential of MSAR as a cost-effective alternative for industrial fuel needs. This trial marked the first commercial-scale demonstration of bioMSAR in an industrial setting, highlighting Quadrise's pioneering role in the industry. Miles elaborated on the trial's success, noting the substantial fuel consumption of the tested unit, comparable to a large container ship. The trial impressively met stringent emission standards, showcasing biofuel's viability in reducing CO2 emissions by over 25%. The stability of MSAR and bioMSAR, maintained for over 12 months, further attests to the fuel's reliability. Looking forward, Quadrise is preparing a technical report for the client and initiating discussions for potential EMSA supply starting in 2024. This includes considering trials at other sites, reinforcing the company's commitment to energy decarbonization. Miles also touched on other projects, including a marine program with MSC, set for a commercial vessel trial in 2024, and a US low-carbon fuels project with Valco. These initiatives, alongside strategic partnerships for biofuel development, underscore Quadrise's proactive approach to sustainable fuel solutions. #QuadrisePLC #JasonMiles #BiofuelTechnology #MSAR #MoroccoFuelTrial #IndustrialFuel #BioMSAR #SustainableEnergy #Decarbonization #EnergyInnovation #RenewableFuel #CO2EmissionReduction #MarineProgramMSC #LowCarbonFuels #ValcoProject #EcoFriendlyFuel #RenewableEnergy #ProactiveLondonInterview #EnergySectorNews #SustainableFuelSolutions
Podcast: Cyber Security Weekly Podcast (LS 38 · TOP 2% what is this?)Episode: Episode 358 - Maritime Cybersecurity – trends and emerging threatsPub date: 2023-05-16Michael Vrettos is a senior Marine Cyber Security Expert for RINA Classification Society in Piraeus. He is responsible for Marine Cyber Security Services and represents RINA in IACS and EMSA related activities.* (* IACS – International Association of Classification Societies, EMSA – European Maritime Safety Agency) His past experience includes working for the EU, NATO & the Defense sector. Among other things, he's been involved in developing a Network Security Operations Center and projects on Cyber Technologies for the European Defense Agency, European Space Agency, EU & NATO. In this interview, Michael gave an introduction to the Maritime sector, and the stakeholders in the industry who are involved in setting the cybersecurity policy and technical standards (for example, IMO (International Maritime Organisation) and IACS (International Association of Classification Societies). He gave a glimpse into how digitalisation in shipping with applications for route optimization, fleet performance and engine automation, (to name a few) driven by increased connectivity and bandwidth along with innovations in satellite technologies, have transformed the sector, with implications for cybersecurity. Hence, in some ways, the ship is increasingly becoming part of an overall “IoT” network. Whilst the NotPetya incident that disrupted the sector in 2017 was an important lesson, Michael also noted the additional complexity of cyber defenses due to “Operational Technology” onboard ships using sensors, PLCs (programmable logic controllers), and various software to control ships systems such as bridge, ballast, engine, navigation, etc. For example, the “always-on” mode means that systems cannot be easily scheduled for patching or for pen-testing in order to avoid an inadvertent disruption. Besides basic cyber hygiene and standard cyber protection at network level, Michael also noted other vessels important systems such as the AIS (automatic identification systems) and ECDIS (Electronic Chart Display and Information System) operating with proprietary software thus making difficult to install typical cyber security measures such as antivirus or antimalware. Wrapping up, Michael shares his views on the digital evolution and emerging cyber threats, such as those introduced by AI (artificial intelligence), and the importance of not only utilizing the benefits of technology but also investing in cyber security considering the potential risks. Recorded 25th April 2023, 10.30am, Marina Bay Sands Singapore, Singapore Maritime Week 2023. The podcast and artwork embedded on this page are from MySecurity Media, which is the property of its owner and not affiliated with or endorsed by Listen Notes, Inc.
Michael Vrettos is a senior Marine Cyber Security Expert for RINA Classification Society in Piraeus. He is responsible for Marine Cyber Security Services and represents RINA in IACS and EMSA related activities.* (* IACS – International Association of Classification Societies, EMSA – European Maritime Safety Agency) His past experience includes working for the EU, NATO & the Defense sector. Among other things, he's been involved in developing a Network Security Operations Center and projects on Cyber Technologies for the European Defense Agency, European Space Agency, EU & NATO. In this interview, Michael gave an introduction to the Maritime sector, and the stakeholders in the industry who are involved in setting the cybersecurity policy and technical standards (for example, IMO (International Maritime Organisation) and IACS (International Association of Classification Societies). He gave a glimpse into how digitalisation in shipping with applications for route optimization, fleet performance and engine automation, (to name a few) driven by increased connectivity and bandwidth along with innovations in satellite technologies, have transformed the sector, with implications for cybersecurity. Hence, in some ways, the ship is increasingly becoming part of an overall “IoT” network. Whilst the NotPetya incident that disrupted the sector in 2017 was an important lesson, Michael also noted the additional complexity of cyber defenses due to “Operational Technology” onboard ships using sensors, PLCs (programmable logic controllers), and various software to control ships systems such as bridge, ballast, engine, navigation, etc. For example, the “always-on” mode means that systems cannot be easily scheduled for patching or for pen-testing in order to avoid an inadvertent disruption. Besides basic cyber hygiene and standard cyber protection at network level, Michael also noted other vessels important systems such as the AIS (automatic identification systems) and ECDIS (Electronic Chart Display and Information System) operating with proprietary software thus making difficult to install typical cyber security measures such as antivirus or antimalware. Wrapping up, Michael shares his views on the digital evolution and emerging cyber threats, such as those introduced by AI (artificial intelligence), and the importance of not only utilizing the benefits of technology but also investing in cyber security considering the potential risks. Recorded 25th April 2023, 10.30am, Marina Bay Sands Singapore, Singapore Maritime Week 2023.
Paar nädalat tagasi teatas Tallink kavandatavast laevapere liikmete suurkoondamisest. Eesti Meremeeste Sõltumatu Ametiühingu juht Jüri Lember annab ülevaate, millise tulemuseni konsultatsioonidel ettevõtte juhtidega jõuti. Lisaks tuleb juttu läbirääkimistest suursaartega ühendust pidavatel parvlaevadel töötavate teenindajate kollektiivlepingute sõlmimiseks. Pikemalt keskendub "Meretund" seekord kalandusele, millest räägib 25 aastat Eesti Kalaliidu tegevust koordineerinud Valdur Noormägi. Saatejuht on Vallo Kelmsaar.
Host: Nene Gianfala, CPA/ABV, CEIV, ASA-BV/IA, Chaffe & Associates, Inc. Guest: Randy Priem, Belgian Financial Services and Markets Authority (FSMA), Finance Professor @ University of Antwerp + UBI Business School Randy Priem is an expert on market infrastructures and financial benchmarks at the Belgian Financial Services and Markets Authority (FSMA). In his white paper (link below) he analyzes the impact of a company's ESG score on its cost of capital, including if a high ESG score serves as a substitute for a weaker legal environment. During our interview, we do a deep dive into · The inspiration for the article · Key factors analyzed and data inputs · How can appraisers incorporate into business valuation? · ESG: fad or common sense? · Beware of greenwashing For Further exploration on this topic: If you're using a podcast app that does not hyperlink to the resources, please visit https://fvssection.libsyn.com/fvs to access the show notes with direct links. If you are interested in learning more about ESG, check out these AICPA resources: AICPA's Fundamentals of ESG Certificate (CPE self-study, 9 credits) FVS podcast episode #53, ESG - Why the Business Valuation Practitioner Should Pay Attention Additional articles on the AICPA website include: ESG reporting: What's the value of ESG? Accounting's role in ESG Resources available as part of FVS Section membership Emerging ESG Regulations Information on SEC disclosures Randy's White Paper, “The Impact of a Firm's ESG Score on Its Cost of Capital: Can a High ESG Score Serve as a Substitute for a Weaker Legal Environment” December 2022 United Nations - https://unglobalcompact.org/take-action/action/private-sustainability-finance European Commission – https://finance.ec.europa.eu/sustainable-finance_en EMSA - https://finance.ec.europa.eu/sustainable-finance_en IOSCO (International Organization of Securities Commissions) (the global organization of securities regulators) https://www.iosco.org/news/pdf/IOSCONEWS635.pdf Financial Stability Board (FSB). https://www.fsb.org/2021/11/environmental-social-and-governance-esg-ratings-and-data-products-providers/ Bank of international settlements https://www.bis.org/publ/qtrpdf/r_qt2112f.htm This podcast episode is part of the extensive resource library available from the AICPA's Forensic and Valuation Services Section, the premier provider of guidance, tools, and advocacy for professionals who specialize in providing forensics, valuation, litigation, and fraud services. If you're not already a member, visit us online and consider joining this active community of your FVS peers. You'll get free CPE and access to rich technical content. Don't miss an episode – Follow us wherever you get your podcasts and leave us a review using this link or copy and paste this URL into your browser https://forms.office.com/r/4cjNd6m1TJ so we can continue bringing valuable and relevant content to you. Any other issues can be sent to podcast@aicpa-cima.com Information on credentials Our FVS credential programs allow AICPA members to demonstrate competence and confidence in providing forensic and valuation services to their clients. · ABV Credential (Accredited in Business Valuation) · CFF Credential (Certified in Fraud and Forensics)
Host: Nene Gianfala, CPA/ABV, CEIV, ASA-BV/IA, Chaffe & Associates, Inc. Guest: Randy Priem, Belgian Financial Services and Markets Authority (FSMA), Finance Professor @ University of Antwerp + UBI Business School Randy Priem is an expert on market infrastructures and financial benchmarks at the Belgian Financial Services and Markets Authority (FSMA). In his white paper (link below) he analyzes the impact of a company's ESG score on its cost of capital, including if a high ESG score serves as a substitute for a weaker legal environment. During our interview, we do a deep dive into · The inspiration for the article · Key factors analyzed and data inputs · How can appraisers incorporate into business valuation? · ESG: fad or common sense? · Beware of greenwashing For Further exploration on this topic: If you're using a podcast app that does not hyperlink to the resources, please visit https://fvssection.libsyn.com/fvs to access the show notes with direct links. If you are interested in learning more about ESG, check out these AICPA resources: AICPA's Fundamentals of ESG Certificate (CPE self-study, 9 credits) FVS podcast episode #53, ESG - Why the Business Valuation Practitioner Should Pay Attention Additional articles on the AICPA website include: ESG reporting: What's the value of ESG? Accounting's role in ESG Resources available as part of FVS Section membership Emerging ESG Regulations Information on SEC disclosures Randy's White Paper, “The Impact of a Firm's ESG Score on Its Cost of Capital: Can a High ESG Score Serve as a Substitute for a Weaker Legal Environment” December 2022 United Nations - https://unglobalcompact.org/take-action/action/private-sustainability-finance European Commission – https://finance.ec.europa.eu/sustainable-finance_en EMSA - https://finance.ec.europa.eu/sustainable-finance_en IOSCO (International Organization of Securities Commissions) (the global organization of securities regulators) https://www.iosco.org/news/pdf/IOSCONEWS635.pdf Financial Stability Board (FSB). https://www.fsb.org/2021/11/environmental-social-and-governance-esg-ratings-and-data-products-providers/ Bank of international settlements https://www.bis.org/publ/qtrpdf/r_qt2112f.htm This podcast episode is part of the extensive resource library available from the AICPA's Forensic and Valuation Services Section, the premier provider of guidance, tools, and advocacy for professionals who specialize in providing forensics, valuation, litigation, and fraud services. If you're not already a member, visit us online and consider joining this active community of your FVS peers. You'll get free CPE and access to rich technical content. Don't miss an episode – Follow us wherever you get your podcasts and leave us a review using this link or copy and paste this URL into your browser https://forms.office.com/r/4cjNd6m1TJ so we can continue bringing valuable and relevant content to you. Any other issues can be sent to podcast@aicpa-cima.com Information on credentials Our FVS credential programs allow AICPA members to demonstrate competence and confidence in providing forensic and valuation services to their clients. · ABV Credential (Accredited in Business Valuation) · CFF Credential (Certified in Fraud and Forensics)
In this episode of Tech Talks Daily Podcast, I'm live at QlikWorld with Jan Birkholz, a process mining evangelist from Mehrwerk, discussing how they support businesses in establishing a data-driven process understanding and optimize their operations. Mehrwerk, a Qlik Elite Solutions Provider, offers software-based business process optimization solutions, utilizing Qlik Sense to help organizations integrate data from multiple sources and transform it into meaningful insights. Jan shares how data visualization plays a crucial role in today's data-driven world and the benefits of Qlik Sense's intuitive software in creating reports and dashboards. We explore the latest version of Qlik Sense, which features personalized dashboards, larger datasets in scatter graphs, and chart animations, and discuss how these enhancements improve user experience and help businesses better understand their data. Jan highlights success stories from clients like Galderma, EMSA, and Agilent, showcasing how Mehrwerk's partnership with Qlik has made a significant impact on their business performance. We also discuss the challenges organizations face when optimizing their processes using data-driven insights and how Mehrwerk's approach helps overcome these obstacles. Finally, Jan shares his vision for the future of business intelligence solutions and data visualization, and the roles that companies like Mehrwerk and Qlik will play in shaping this landscape. Tune in for valuable advice on how businesses can leverage data more effectively and become more agile in today's competitive market.
Enrollees commit to work for the authority for 18 months, but could also opt to enroll in the EMSA's paramedic program
Springtime can bring severe weather to Oklahoma, and Colin Perry of Perry Weather Consulting joins us first to explain how his proprietary weather forecasting technology keeps runners safe along the course. Then avid marathoner, Peloton runner and recent Oklahoma transplant Erin Welch stops by to talk about why she's excited to run her first Memorial Marathon. And lastly, EMSA Division Chief and Memorial Marathon Medical Operations Section Chief Z. Yazdanipour tells us about the Marathon's emergency medical services and firsthand experience as a volunteer in the Oklahoma City bombing recovery efforts.Follow the Oklahoma City Memorial Marathon on Facebook, Twitter and Instagram for the latest marathon updates and visit www.OKCMarathon.com to sign up to run, volunteer or learn more! Facebook: https://www.facebook.com/OKCMarathonTwitter: https://twitter.com/okcmarathonInstagram: https://www.instagram.com/okcmarathon
During this episode, Dr Andrew Horwood connects with us over Zoom and shares some personal history and wisdom. Andrew is the standing Treasurer of EMSA, a practising GP and pain specialist, and a former resident of Riverdell Spiritual Centre. We discussed the social atmosphere of his youth when Marxist Philosophy became a popular response to the horrors of WW2. A time in which many intellectuals resonated with Karl Marx's adage that “Religion is the Opium of the People.” We learn of Andrew's journey of self-discovery, the profound realisation sparked by the birth of his children, as well as his evolution as a medical GP. Andrew speaks about his connection to the Emissaries and his appreciation for Lew Childre, the founder of the Heartmath foundation, and we consider the importance of grief, tears, and community. Please join me in this conversation, and I hope you enjoy listening to it as much as I enjoyed recording it. If you are interested in learning more about the Heartmath foundation, Watch this Video for a better understanding.
Tazedirekt Sohbet'te Tuba Şatana'nın bu haftaki konuğu aşçı Şemsa Denizsel. Mutfakta cesaret, malzemeye yaklaşım, kent hayatından zeytin ağaçlarına uzanan iştahlı bir sohbet oldu. Keyifli dinlemeler!
"Yakası yıpranan gömleğimi de atmam, bayat ekmeğimi de... Bu utanılacak bir şey değil, marifettir." Aşçı Şemsa Denizsel, Artan Mutfağı projesini anlatıyor.
"Yakası yıpranan gömleğimi de atmam, bayat ekmeğimi de... Bu utanılacak bir şey değil, marifettir." Aşçı Şemsa Denizsel, Artan Mutfağı projesini anlatıyor.
Lo spazio per la prevenzione, preparazione e risposta alle crisi che minacciano la sicurezza degli europei. I 3 servizi di CopernicusEU per la sicurezza delle frontiere, dei mari e il sostegno all'azione esterna dell' UE. Cosa disse a Massimo il professore di Geopolitica all'Università parlando della geografia?
Ioannis Mispinas is Head of Safety and Security Unit at the European Maritime Safety Agency which was founded exactly 20 years ago and is located at the shores of Tejo in Lisbon, Portugal. How exactly does EMSA affect the maritime policies of the EU Member States and how will maritime accident response look like in 2050? Listen to our latest podcast with Ioannis and find out.
Welcome to Tulsa Talks presented by Tulsa Regional Chamber. I'm your host Tim Landes.For this month's issue of the magazine, I wrote about the staffing issues that are impacting our first responders in policing, fire and EMSA and how they're trying to fill the gaps in protection. I also took part in a ridealong with TPD patrol officer John Shelton, who works in the Mingo Valley Division, which is based in east Tulsa. It's the busiest division in terms of calls, and the November night I was in a car, the calls were nonstop. I wrote about some of that experience to highlight the job they have to do while short staffed. I also shared a photo gallery in the online version story. I talked to both Police Chief Wendell Franklin and Fire Department Chief Michael Baker. Both are in their second year on the job, and both have their own challenges to face to help keep Tulsa safe. Both men shared way more info than I could fit in the story, so I'm doing it here. Franklin is a repeat guest of the podcast, but this was the first time I sat down with him face-to-face to interview him. We talked in his office on Nov. 16. Something I like about Franklin is he's a history buff and a reader. He filled me in on the Daniel Silva spy series that filled a shelf or two after we talked about his job. And now I have more books to read.In this conversation, you'll hear Franklin talk about the morale of his officers before getting into why they are stretched thin. He talks about how staffing issues are impacting community policing, which he calls collaborative policing. He also discusses the benefits of the pay raise and the pros and cons of the TPD's 4-year degree requirement. One of the most complicated topics of the year is the McGirt decision, which upholds tribal sovereignty and has an impact on policing. Local politicians have shared their opinions. I wanted to hear from Franklin his thoughts on how they are handling the changes and what can be done to make the transition easier for everyone. He then concludes by talking about the year in crime. Homicides are down and violent crime is up. Franklin shares his thoughts maybe why this is the case.After my conversation with him, hear from TFD Chief Baker on how they've overhauled the application and hiring process to take the department into the 21st century. He also talks about the morale of a department that has seen many fire fighters retire and is currently in arbitration for more funding to pay fire fighters and fix equipment. ***The guys who make up Jasper Wilderness took advantage of the pandemic to grow together as a band. In November the alt-rockers released their five song EP “Coming Home to Silence.” Coming in our January issue is a story about the release. Lead singer Gabe Philips says: “Coming Home to Silence" was born out of a lot of artistic writing sessions that we wouldn't have been able to have without the lockdown. The band is a small, tight-knit group and were able to meet during the craziness and get good creative energy/get on the same page about how to pursue music. Now the band has a great foundation for stepping out and playing live.”And with that here is the EP track “Alibi.“
ESPAÑOL:Douglas Augusto Guilherme es el Vice Presidente de Cadena de Suministro Global de Ecolab. Anteriormente se desempeñó como Vice Presidente de Supply Chain International Mkt - IMEA, Japón, Corea, ANZ, SEA, Latinoamérica durante 2 años. Previamente a Ecolab, pasó casi dos años en Fonterra en Operaciones, Compras, Cadena de Suministro e Innovación y Sustentabilidad. Previo a Fonterra, trabajó en Procter & Gamble durante 13 años, teniendo diferentes responsabilidades en Brasil, Panamá y Colombia, siendo la última Director Senior de Compras y Abastecimiento de Productos para LatAm e IMEA. Antes de trabajar en P&G, pasó algunos años en EMS, Akzonobel y Avon en puestos de logística y fabricación. Algunos de los aspectos más destacados del podcast:Tus tiempos iniciales en AvonLos aprendizajes en AkzoNobelTu traslado a EMSUna nueva carrera por venir en Procter & GambleTu experiencia en Foterra en Chile.Nueva experiencia Ecolab¿Qué recomiendas a las personas nuevas que buscan hacer carrera en Supply Chain?¿Qué habilidades considera que son clave para los líderes de la cadena de suministro?Su recomendación final para SC Professionals.ENGLISH:Douglas Augusto Guilherme is the Vice President of Global Supply Chain at Ecolab. He previously served as Vice President Supply Chain International Mkt - IMEA, Japan, Korea, ANZ, SEA, Latin America for 2 years. Previously to Ecolab, he spent almost two years in Fonterra as Operations, Purchases, Supply Chain, and Innovation & Sustainability. Previous to Fonterra, he worked in Procter & Gamble for 13 years, having different responsibilities in Brazil, Panama and Colombia, being the last one LATAM and IMEA Product Supply Procurement Senior Director. Before working in P&G, we spent some years in EMS, Akzonobel and Avon through Logistics and Manufacturing roles. Some of the highlights from the podcast:Douglas' initial times in AvonThe learnings in AkzoNobelMovement to EMSA new career to come in Procter & GambleYour experience in Foterra in Chile. Ecolab new experienceWhat do you recommend to new people looking for making career in Supply Chain?Final recommendation for SC Professionals.Discover more details here.Follow us on:Website: https://bit.ly/32bR2GrInstagram: http://bit.ly/2Wba8v7Twitter: http://bit.ly/2WeulzXLinkedin: http://bit.ly/2w9YSQXFacebook: http://bit.ly/2HtryLd
Šemsa ist freie Journalistin, stammt aus Nordmazedonien und erzählt mir in Folge 16 über die Pflichten einer albanischen Frau, warum die albanische Community ein Sexismusproblem hat und warum sie aus dem Raster tanzt. Hört euch die neue Folge jetzt an! ➡️Vergesst nicht, Gut integriert auf eurer Streaming-Platform zu abonnieren, um keine Folge mehr zu verpassen! ➡️Abonniert @gutintegriert und auf Instagram! ➡️Du hast eine Frage zur Folge oder möchtest auch zu Gast bei Gut integriert sein? Kontaktiere mich auf Instagram oder schreibe mir eine Nachricht auf gutintegriert@gmail.com
Working safely in Oklahoma is about preparedness. Not only do you need to contact OKIE811 prior to your excavation projects, you need to be prepared to work in Oklahoma extreme temperatures as well. John Graham with EMSA Oklahoma shares with us how to be prepared and stay safe when working in the heat of summer, and the cold of winter.
Link to bioRxiv paper: http://biorxiv.org/cgi/content/short/2020.07.13.200352v1?rss=1 Authors: Fatima, N., Gromnicova, R., Loughlin, J., Sharrack, B., Male, D. Abstract: Treatment of diseases that affect the CNS by gene therapy requires delivery of oligonucleotides to target cells within the brain. As the blood brain barrier prevents movement of large biomolecules, current approaches involve direct injection of the oligonucleotides, which is invasive and may have only a localised effect. The aim of this study was to investigate the potential of 2 nm galactose-coated gold nanoparticles (NP-Gal) as a delivery system of oligonucleotides across brain endothelium. DNA oligonucleotides of different types were attached to NP-Gal by the place exchange reaction and were characterised by EMSA (electrophoretic mobility shift assay). Several nanoparticle formulations were created, with single- or double-stranded (20nt or 40nt) DNA oligonucleotides, or with different amounts of DNA attached to the carriers. These nanocarriers were applied to transwell cultures of human brain endothelium in vitro (hCMEC/D3 cell-line) or to a 3D-hydrogel model of the blood-brain barrier including astrocytes. Transfer rates were measured by quantitative electron microscopy for the nanoparticles and qPCR for DNA. Despite the increase in nanoparticle size caused by attachment of oligonucleotides to the NP-Gal carrier, the rates of endocytosis and transcytosis of nanoparticles were both considerably increased when they carried an oligonucleotide cargo. Carriers with 40nt dsDNA were most efficient, accumulating in vesicles, in the cytosol and beneath the basal membrane of the endothelium. The oligonucleotide cargo remained attached to the nanocarriers during transcytosis and the transport rate across the endothelial cells was increased at least 50fold compared with free DNA. The nanoparticles entered the extracellular matrix and were taken up by the astrocytes in biologically functional amounts. Attachment of DNA confers a strong negative charge to the nanoparticles which may explain the enhanced binding to the endothelium and transcytosis by both vesicular transport and the transmembrane/cytosol pathway. These gold nanoparticles have the potential to transport therapeutic amounts of nucleic acids into the CNS. Copy rights belong to original authors. Visit the link for more info
Seekord on Meretunnis juttu nn laevanduspaketi mõju esimestest ilmingutest ja Eesti lipu alla toodud kaubalaevadest, meremeeste maksustamisest ja tänavuse meremeeste päeva erisusest koroonakriisi valguses. Räägivad Veeteede Ameti peadirektori kohusetäitja Marek Rauk, EMSA esimees Jüri Lember ja peasekretär Kaia Vask. Saatejuht on Vallo Kelmsaar.
Seekord on Meretunnis juttu nn laevanduspaketi mõju esimestest ilmingutest ja Eesti lipu alla toodud kaubalaevadest, meremeeste maksustamisest ja tänavuse meremeeste päeva erisusest koroonakriisi valguses. Räägivad Veeteede Ameti peadirektori kohusetäitja Marek Rauk, EMSA esimees Jüri Lember ja peasekretär Kaia Vask. Saatejuht on Vallo Kelmsaar.
The need for advanced patient ventilation has been at the forefront of patient care during the coronavirus pandemic. The shortage of mechanical ventilators has also surfaced as an overall shortfall in many systems.Many have raised the issue of why few prehospital response ALS Units are equipped with mechanical ventilators. JEMS Editor Emeritus A.J. Heightman reached out to EMSA, the ALS System serving Tulsa and Oklahoma City, a system that has mechanical ventilators in service for years, to discuss the topic.Joining A.J. are Jeffrey M. Goodloe, MD, NRP, FACEP, FAEMS, and Tyler Wedman, NRP.Jeffrey M. Goodloe is professor and chief of the EMS Section of the Department of Emergency Medicine at The University of Oklahoma School of Community Medicine in Tulsa. He has the privilege of serving as medical director for the Medical Control Board in the EMS System for Metropolitan Oklahoma City and Tulsa, working with a multitude of agencies, including the Emergency Medical Services Authority (EMSA), the Oklahoma City Fire Department and the Tulsa Fire Department. He started in EMS in 1988 as an EMT-B and has never quit learning.Tyler Wedman works for Global Medical Response in its operations at EMSA in Oklahoma City. He serves as Director of Clinical Services for EMSA in the “Western Division” which is metropolitan Oklahoma City. He oversees new hire clinical onboarding, CQI, CME, and other clinical and educational duties.
Mirgün Cabas Şemsa Denizsel'e nasıl gidiyor karantina diye soruyor.
Nick walks us through the day and life of a paramedic. Plus, EMSA's therapy dog, Jude.
Bu bölümde konuğumuz Şemsa Denizsel. Kantin lokantası ile İstanbul'un göbeğinde yıllarca marka olan usta, şimdi Cooks Grove projesi, Kulaktan Dolma Tarifler kitabı ve YouTube kanalı ile üretmeye devam ediyor. Ayvalık'ta aşık olduğu zeytinlik ve gelecek projeleri üzerine konuştuk.
A little later than planned, but here is the podcast round up of the St Emlyn's blog for August 2018. The following blogs are discussed. Lessons learned at EMSA https://www.stemlynsblog.org/lessons-learned-at-emsa18/ Troponin and Biotin https://www.stemlynsblog.org/troponin-and-biotin-a-lethal-combination/ Top apps at EMSA https://www.stemlynsblog.org/top-apps-at-emsa18-st-emlyns/ Navigating the CESR route in UK emergency medicine training https://www.stemlynsblog.org/et-tu-brute-one-mans-battle-with-cesr-st-emlyns/ JC: IV fluids review paper https://www.stemlynsblog.org/jc-intravenous-fluid-therapy-in-critically-ill-adults-review-st-emlyns/ Moral Injury in emergency medicine https://www.stemlynsblog.org/moral-injury-in-emergency-and-pre-hospital-care-esther-murray-on-st-emlyns-podcast/
Nesse episódio do NeuroPod vamos elucidar a relação entre Zika e Microcefalia em 5 perguntas-chave. Também teremos a entrevista exclusivíssima com a neurocientista Patricia P. Garcez, professora da UFRJ, especialista em microcefalia e pioneira nos estudos com Zika. Link para o Lattes da prof. Patricia P. Garcez: http://lattes.cnpq.br/7284551536353300 Referências bibliográficas do episódio: 1. Secretaria de Vigilância em Saúde, Ministério da Saúde. Boletim Epidemiológico. Vol 47 número 14, semana epidemiológica 8; 2016. 2. Centro de Operações de Emergências emSaúde Pública sobre Microcefalias COES. MONITORAMENTO DOS CASOS DEMICROCEFALIA NO BRASIL. Vol 19. SE 12; 2016. 3. Paixão ES, Barreto F, da Glória TeixeiraM, da Conceição N. Costa M, Rodrigues LC. History, Epidemiology, and ClinicalManifestations of Zika: A Systematic Review. Am J Public Health.2016;106(4):606-612. doi:10.2105/AJPH.2016.303112. 4. Zanluca C, de Melo VCA, Mosimann ALP, dosSantos GIV, dos Santos CND, Luz K. First report of autochthonous transmissionof Zika virus in Brazil. Mem Inst Oswaldo Cruz. 2015;110(4):569-572.doi:10.1590/0074-02760150192. 5. Instituto Nacional de Salud. Boletín EpidemiológicoSemanal. Vol Semana 5; 2016. Colômbia 6. Instituto Nacional de Salud. Boletín EpidemiológicoSemanal. 2016; Semana 11. Colômbia 7. Cruz R. Dados preliminares confirmam apresença do Zika vírus em Sergipe. Portal da saúde.http://saude.se.gov.br/index.php/2016/03/11/dados-preliminares-confirmam-a-presenca-do-zika-virus-em-sergipe/.Published 2016. 8. Escobar E. Zika e microcefalia : O mistériode Sergipe – resolvido. Estadão.http://ciencia.estadao.com.br/blogs/herton-escobar/zika-e-microcefalia-o-misterio-de-sergipe-resolvido/.Published 2016. Accessed April 3, 2016. 9. Butler D. Zika and birth defects: what weknow and what we don’t. Nature. 2016:1-7. doi:10.1038/nature.2016.19596. 10. World Health Organization. Microcephaly. Mediacentre, fact sheet.http://www.who.int/mediacentre/factsheets/microcephaly/en/. Published March 2,2016. 11. Calvet1 G, Aguiarv RS, Melo AS, et al.Detection and sequecing of Zika virus from amniotic fluid of fetuses withmicrocephaly in Brazil: a case study. Lancet Infect Dis.2016;3099(16):In press. doi:10.1017/CBO9781107415324.004. 12. Fountora R. Zika atinge placenta emqualquer fase da gestação. Agência fiocruz de notícias.https://agencia.fiocruz.br/zika-atinge-placenta-em-qualquer-fase-da-gestacao.Published March 14, 2016. 13. Garcez PP, Loiola EC, Costa RM da, et al.Zika virus impairs growth in human neurospheres and brain organoids. PeerJPrepr. 2016:1-21. Créditos da música: Adam Selzer, Charmed Life.
Jacqui Ford, Jacquelyn Ford Law, P.C.: Welcome to Your Best Defense podcast. My name is Jacqui Ford, and we’re talking today about DUIs, DWIs, and what Oklahoma calls actual physical control. These are all crimes that you could be facing if you engage in an activity including drinking and driving. There is a huge misconception in this world about what is legal, and what is not legal. There’s no law that says you cannot have a drink, and then drive a car. The law says you cannot drive a car while impaired or under the influence of alcohol. What does that mean in application? Well, real briefly, we have three different types of drunk-driving in Oklahoma. The first one is DWI. We don’t see a whole lot of DWI charges because it’s a very limited number of folks. DWI stands for driving while intoxicated, and it’s something less than DUI. It generally applies when your blood alcohol content 0.05 to 0.07. So, it’s less than the mandatory requirement for DUI which is a 0.08 blood alcohol content. But it’s something greater than, “I’ve had a drink, and I got in the car.” So, DWI is the first charge that you might see when dealing with DUI charges in the state in Oklahoma. Although, it’s not applied as often, it is certainly a nice benefit for individuals who were charged with DUI, and the scientific evidence comes back and says maybe they weren’t. It carries pretty much the same range of punishment. The consequences for probation are pretty much the same. So, we’ll kind of skip over DWI for those purposes, and talk about what most of us know to be drunk driving in Oklahoma. It’s called driving under the influence – DUI. Sometimes, referred to as a ‘dewey.’ DUI simply means that you are driving a vehicle under the influence of alcohol, law enforcement believes that either by scientific evidence, or subjective evidence of their observations, that you’re body is under the influence, and therefore, you’re not safe to drive. The range of punishment for DUI in Oklahoma is very great. Much like some of our other charges, like possession of marijuana, and domestic violence that we’ve talked about in the past. Your first time DUI is almost always treated as a misdemeanor, unless it has some aggravating characteristic. So, most folks first-time DUI is a misdemeanor. The range of punishment is a mandatory 10 days in the county jail, up to a year, and up to a $1000 fine. Many people think about DUIs and they realize that a lot of their friends and family members have them. It has a very morally unsound connotation. And judges are harsh on DUIs. And prosecutors are harsh on DUIs. And our legislature, as we speak right now, are trying to make DUI charges and convictions enhanceable so that people will be charge with felonies in a quicker, more efficient way. So, they can be very, very dangerous. They’re also one of the most common crimes we commit, and also one of the safest crimes to commit. What you have to know, if you’ve been charged with a DUI, or you’re being arrested for a DUI, is how to interact with law enforcement, and what to expect moving forward. So, if you’re pulled over, and you’ve had a few drinks, and you know that the police officer’s going to ask you a serious of questions. My first advice to folks is you’re not require to answer any of their questions. You’re only required to give your driver’s license and insurance verification. And if you can find a polite, respectful way to decline other questions, that’s my first piece of advice. You have a Fifth Amendment right to remain silent. I strongly encourage that you use it. And you can do it in a simple way as saying, “Officer, I do not wish to engage in consensual contact, and answer any of your questions at this time.” That sounds a lot easier said than done. We want to engage with law enforcement, and we want to answer their questions, and they know that. They’re banking on the fact that we’re going to be a little bit nervous. But, what you have to understand is that these questions are designed to elicit answers that give rise to arrest you for DUI. So, if you answer those questions, you are causing yourself more harm than good. One of the that a law-enforcement officer will ask you to do if he believes that you’re driving under the influence of alcohol, is engage in field-sobriety tests. And you’re not required to engage in field-sobriety tests. And, in fact, I encourage most people not to do so. The tests are incredibly subjective. They’re set up for you to fail, and the officer’s observations, especially if you’re not recorded, and here in Oklahoma City most law-enforcement officers are not equipped with dash-cams or body-cams to be able record your actions. So, the evidence that’s going to be presented against you is simply the police officer’s interpretation of how well you followed those instructions. And usually, that is not to your benefit. So, I would encourage you to resist the urge to prove your sobriety by getting up and doing field-sobriety tests. Those tests are designed to make you look guilty, and have you arrested. The next question everybody always asks is, “Do I blow, or do not blow, into the Breathalyzer machine?” And this is a very sensitive topic. And everybody asks drunk-driving lawyers this question all the time. If we represent people in DUIs, should I blow, or should I not blow? And, 10 years ago, the answer was if you think there’s a possibility that you might be DUI don’t blow. Because you’re giving them evidence to convict you criminally. Now, a DUI charge has two elements to it. Not only do you have a criminal battle to fight – whether, or not you’re going to jail and paying $1000 fines for your actions. But, you also have a civil matter going on. And that’s through The Department of Public Safety. And The Department of Public Safety says that you do not have a right to drive a vehicle in the state of Oklahoma. You have the privilege to drive a vehicle in the state of Oklahoma. And they, with all of their incredible lobbying, expenses, have lobbied the legislature, and have really changed the way DUI laws are handled and how people give advice. If you refuse to blow in a Breathalyzer, and law enforcement has suspected and accused you of DUI, your refusal to blow will result in the revocation of proceedings from The Department of Public Safety. Depending on your history, and if you’ve ever had DUIs in the past, how long you’ll be revoked, and how long you’ll be subjected to what we call a modified driver’s license, is determined based upon your priors. But a refusal’s going to revoke you for at least six months. And in order to get re-instated you will have to put a breathalyzer in your car for an additional 18 months. So, a refusal means two months of a breathalyzer in your car if we lose DPS hearings, and we don’t have any other issues to deal with there. So, whether to blow, or not blow, only you know how much you’ve had to drink. If you know you are not above the legal limit of 0.08, then I would certainly encourage you to consider blowing for two reasons. Number one, it will give exculpatory evidence to you DUI charge, and we may be able to get it down to a DWI or complete dismissal. In the alternative, it keeps your driving privileges intact with The Department of Public Safety. There are other ways that DUIs can go down. We could talk for hours about defending DUIs in Oklahoma, but we just have a limited amount of time. So, we’re going to move quickly to how you find yourself charged with a felony DUI. If you have been arrested, and entered a plea, and been convicted for a DUI within the last 10 years, your next DUI is very likely to be filed as a felony charge. So, you get one shot a misdemeanor, and if you pick up another one it’s very likely you’ll be dealing with a felony charge. The range of punishment there is one year to five years in The Department of Corrections, and an increased fine. Your second felony within 10 years carries 1 to 10 years in The Department of Corrections, and a $5000 fine. And your third felony DUI within 10 years carries up to 20 years in The Department of Corrections and up to a $5000 fine. It is clearly obvious that the legislature is trying to discourage folks with chronic drinking problems from getting behind the wheel of the car. Not telling you not to drink. They’re telling you not to get behind the wheel of the car and put at risk the lives of everybody else on the road. How else do you find yourself with felony charges with a DUI? One of the things we see more, and more often, is that the driver has a child in the car. If you have a child in the car, and you’re arrested for, suspected of, and charged with DUI, you can likely expect to get charged with child endangerment, as well. Which is a felony crime – carries up to four year in The Department of Corrections and up to a $5000 fine. Another quick way to make an otherwise benign, simple DUI a felony is if you’re involved in an accident that results in personal injury of another person. That is problematic, and it is an enhancer, and depending on your priors, and facts and circumstances could give rise to felony charges. It could give rise to simply a misdemeanor charge of personal injury DUI which carries up to a year and up to a $2500 fine. What happens if you are charged, and you go to court, and you decide to enter a plea. Well, Oklahoma laws are pretty specific. And each municipality kind of deals with these things in their own vein. But if we’re dealing strictly with state court, and that’s probably the best way to do it for these purposes, is upon a plea of guilty, or no contest, and a finding of guilt by a judge, whether we’re convicted of the DUI, or we’re placed on a simple deferred, Oklahoma law mandates that we do some things. The first thing you’re going to have to do is a drug and alcohol assessment, and any follow-up that they recommend. That’s conducted by a state-qualified assessor. It’s a battery of questions. They take you’re answers and plug them into a formula and they make recommendations as to what you need to do address the issues that found us here. Oftentimes, experienced assessors also know what the law is. And they know upon a finding of guilt, or a plea, that you’re going to have to engage in two other programs. So, we know we’re going to have to do a drug and alcohol assessment of some kind. And it’s very likely, that as a result of that assessment, the follow-up recommendations will be that you go to a DUI school, and a victims’ impact school. DUI schools come in different varieties. First-time offenders are generally only required to do a 10 hour DUI school. That means you go to class for 10 hours. It’s an active participation. There’s a workbook. There’s some defensive driving skills in there. Basically, it’s about informing you what physiologically happens in your body when you drink to discourage you from engaging in further drinking and driving. If you’re a repeat offender it is possible that you will be required to do a 24 hour DUI school. Almost everyone is required to go through a victims’ impact panel. A victims’ impact panel is something that has kind of been supported, and pushed through, by Mothers Against Drunk Drivers. It is designed to inform, scare, and shame the participants into seeing what is the worst-case scenario. Although, most people engage in driving while having had a couple of drinks, and most people will do this repeatedly throughout their entire life, and never be in a car accident. It is the rare occasion that a car accident occurs, and fatalities occur. And this fear of this happening is what is really driven DUI laws to become so strict. Victims’ impact panel is a one-time event that you go, and you will listen to three individuals who have been directly impacted by DUI. Most likely, you’re going find a first responder, a police officer, an EMSA driver, a fireman. They’re going to show you a series of videos and images of mangled cars, and damaged bodies. And they’re going to talk to you about the impact that arriving on these scenes have upon them personally. It’s a very emotional experience. The next person you’re likely to hear from is someone who has been directly affected. Either they’ve lost a loved one, or they’ve been mangled and majorly injured themselves. They are the victim of the DUI, and they will share their story to explain to you the impact that this has had on their life. And then, the third person you generally hear from is an offender. Usually working some rehabilitative program. And part of that is to come out and share his story. And he will come out and talk about the consequences he suffered both emotionally, mentally, and legally when he engaged in drunk driving and was ultimately, probably caused someone some very serious harm. And has suffered long-term effects, as opposed to most folks who just get to plead to probation. And that’s a quick overview of what to expect in a DUI case. Every municipality deals with the order in which you’re going to do it, and where you need to go, in different specific ways. So, it’s important that if you’re charged with DUI, or DWI, that you contact an experienced DUI lawyer. Someone who deals in defending drunk driving cases, so they can direct you so you’re not using your money superfluously and doing things that are unnecessary because you’re going to have to do it another way. Finally, one of the ways that you can be charged under a drunk driving statute in the state of Oklahoma is a thing called actual physical control. Actual physical control is a real interesting charge in the state of Oklahoma, because what it’s saying is that you’re not driving a vehicle, but you have keys, the vehicle is operational, and you’re drunk. Therefore, they hold you to the same level of responsibility as if you had actually put the keys in the ignition and got on the road. This is dangerous and scary because many folks have been told, you know, if you’re driving and you realize you that you’re a little too drunk to drive the best thing to do is to pull over. Crawl in the backseat and take a nap. Sleep that off so that you don’t continue to put yourself and others at risk. Because of our aggressive legislative needs, and our policies here in Oklahoma, actual physical control, when you make a decision to not drive, but to remain in, or around, your vehicle while your intoxicated, the court system and the cops are going to treat you exactly the same as if you’d gotten in that car and driven off. The statute fall under the same statute of DUI. The range of punishment is exactly the same. And the motivation to do the right thing quickly goes away. People come all the time and ask, “How could this have happened? I was trying to do the right thing by not driving my vehicle.” The sad reality is, the way the laws as they exist today almost encourage DUI because it’s better to take the risk of going and not getting pulled over, than to do the right thing and pull over in a parking lot in a safe, lit environment. Because there’s a strong likelihood that someone’s going to report you. Or, law enforcement will show up. And the damage is just as bad as if you had just gone ahead and driven home. With respect to DUI defense in Oklahoma, those are the three primary things that you would see: DUI, DWI, and actual physical control. It’s important that if you are arrested for this charge, the sooner you get in with a lawyer the better. Because we can start navigating your way through this obstacle that is the criminal justice system. And the sooner we get started, the easier it is for you. and the more beneficial it is for defending your case. Whether, or not, we’re working towards a plea negation. Or, whether, or not, we’re working towards an .ultimate trial for the purposes of acquittal. The sooner you get in with your lawyer, and start strategizing the better. And that’s all we have to say today about drunk driving in Oklahoma. Thanks for joining us. We’ll be back next week with another topic.
Shipping Podcast - listen to the maritime professionals in the world of shipping
Markky Mylly, Managing Director of the European Maritime Safety Agency, EMSA, formerly employed by the Finnish Maritime Administration, but above all a "tanker-man" is running EMSA in Lisbon, which is the link between the member states and the European Commission when it comes to maritime regulations. Markku is of the opinion that the shipping industry is fulfilling the SECA regulations which came into full force Jan 1st, 2015. They have recorded more than 6,000 measurements and the majority is in compliance. Every year, more than 2,800 maritime incidents and accidents within European waters are reported to EMSA. Markku thinks that the 80 serious accidents reported last year has to be reduced, every accident means environmental and economic implications, but the fatal accidents has to be brought down to a minimum. People don't understand that Europe is totally dependent on shipping, it's paramount that we raise the profile of shipping. Have you got the recipe for spreading the word about shipping and the Shipping Podcast in particular? It's through sharing the fact that there is a Shipping Podcast and then writing a review. Please, feel free to put your view forward - it's easy!
Jeanette hat seit zwei Tagen Urlaub und war schon fleißig. Sie hat ihr neues Auto auf Vorderfrau gebracht. Michaela berichtet, über die Tunig World, eine der größten Tuning Messen. Der Smart ist Jeanettes erstes eigenes Auto. Michaela hatte ihr erstes Auto mit 18. Michaela hat sich letztens eine Wasserflasche von Klean Kantin gekauft und einen Thermobecher von Emsa. Die Wasserflasche wird sie mit zum Podstock Festival mitnehmen. Jeanette und Michaela freuen sich auf das kommende Wochenende bei Wolfsburg. Michaela hat letztens ein interessantes Projekt entdeckt und zwar Avoce, Shownotes rückwärts. Michaela berichtet, das die Blogsuche von Google eingestellt wurde. Jeanettes Podcatcher App ist in der Reviewphase bei Apple. Sie hofft, daß es dabei keine Probleme gibt und sie bald im App-Store erscheint. Michaela macht Jeanette darauf aufmerksam, daß wir immer noch ein Vorläufiges Logo nutzen und wir doch langsam mal ein eigenes Logo für den Podcast entwickeln sollten. Michaela muß morgen am Mittwoch zu einer Beerdigung, ihr Bruder ist letzte Woche gestorben. Jeanette und Michaela unterhalten sich darauf hin über ihre Erfahrungen mit Familie. Freunde sind wichtig, es ist aber nicht einfach welche zu finden. Jeanette war letztes Wochenende bei einem Fotoshooting in Nürnberg im Volksbad, einem alten Bad in der Nähe der Nürnberger Burg. Die Bilder wird sie demnächst auf einer eigenen Facebook-Seite veröffentlichen. Michaela schwärmt von Leipzig, die sie vielleicht in ihrem Urlaub wieder besuchen wird. Michaela möchte in ihrem Urlaub, die Bachritterburg Kanzach besuchen, wo gerade an dem Wochenende, wo Michaela und Jeanette bei Wolfsburg sind, ein besonderes Ereignis stattfindet. Jeanette hat drei Viktorianische Kleider. Jeanette hat im September ein Problem mit Terminen. Michaela wird im September beim Barcamp in Stuttgart sein. Jeanettes Arbeitssuche gestaltet sich auf Grund der Urlaubszeit gerade ein wenig träge. Jeanette und Michaela berichten über Kolleginnen und Kollegen, die sehr sportlich sind und mit Fahrrad oder joggender Weise zur Arbeit kommen. Zum Abschluß erinnern sich Jeanette und Michaela noch an Dinge, die sie mit zum Podstock Festival mit nehmen wollen. Beide freuen sich auf die Reise nach Wolfsburg.
Fakultät für Biologie - Digitale Hochschulschriften der LMU - Teil 05/06
The use of selectively bred mouse models of enhanced fear and/or anxiety-related behavior provides a unique opportunity to identify genetic targets that contribute to pathological anxiety. However, dealing with animal models needs accurate information about their phenotypes. Accordingly, high (HAB), normal (NAB) and low (LAB) anxiety-related behavior mice – a validated model of anxiety disorders - were repeatedly tested in a variety of behavioral paradigms. Whereas most tests to assess anxiety traits are based on fear of novel and open spaces, we took advantage of the inborn fear and associated avoidance of the predator odor (trimethylthiazoline (TMT)) as a measure of anxiety-related behavior. We were able to show that avoidance of TMT reflects the high anxiety phenotype of HAB mice, indicated by the decreased time animals spent in the chamber with TMT compared to NAB and LAB mice. Importantly, this result is not confounded by any deficit of the olfactory system, since mice responded to both the pleasant odor of female urine and the repugnant odor of butyric acid. To take the influence of environmental stimuli on inborn anxiety further, we next studied the impact of environmental manipulations on the genetically driven phenotype of LAB mice. Therefore, animals were exposed to a series of chronic unpredictable mild stressors (CMS). CMS-treated mice displayed increased anxiety in the TMT-avoidance test, elevated plus-maze (EPM) and light-dark box (LDB). Moreover, these animals were characterized by increased depression-like behavior and a blunted neuroendocrine regulation. Furthermore, TMT-exposure promoted a higher activation of immediate early gene expression, e.g. c-fos, in the amygdala, especially in the basolateral nuclei (BLA). c-Fos expression pattern correlated with anxiety-related behavior after CMS. Importantly, our electrophysiological studies also indicated a higher activation of amygdala in LAB mice after CMS treatment. Since corticotropin releasing hormone (CRH) is one of the most important mediators of amygdala activity and is largely involved in the regulation of the anxiety-related behavior, we hypothesized that environmental influences are translated via an altered CRH system. Previous experiments had shown that enriched environment (EE) induced a down-regulation of Crhr1. Here, we report that CMS induced higher expression of Crhr1 in the BLA of LAB mice, in contrast to EE. Thus, these data indicate, that Crhr1 expression might be plastic in response to both, beneficial and detrimental, environmental factors. Thereafter, we studied the role of DNA methylation as a probable mechanism behind the different gene expression. Using pyrosequencing of the bisulfite-converted DNA, one specific CpG site (CpG1) of Crhr1 was found to be higher methylated after both treatments. In order to evaluate functional importance of this modification, we tested the impact of CpG1 methylation on promoter activity using the luciferase assay and observed that the presence of methylation reduced promoter activity. Moreover, elevated methylation decreased the binding efficiency of the transcription factor Yin Yang 1 (YY1) as indicated by electrophoretic mobility shift assay (EMSA). Furthermore, we analyzed whether a higher expression of YY1 in the BLA of LAB mice, observed after CMS, contributed to the elevation of Crhr1. Indeed, overexpression of YY1 in the neuronal cell culture enhanced both Crhr1 expression and Crhr1 promoter activity. Finally, we estimated the effects of combininig CpG1 site-specific methylation with YY1 overexpression on Crhr1 promoter activity and tested whether in vitro overexpression of YY1 induced methylation of CpG1. Altogether, our data suggest that even a rigid genetic predisposition to low anxiety-related behavior could be rescued by environmental modification and provide evidence that the epigenetic regulation of Crhr1 expression in the BLA is a possible underlying mechanism behind.
Background: Prostate smooth muscle tone is regulated by alpha 1-adrenoceptor-induced contraction and cAMP-mediated relaxation. EPAC is an effector of cAMP, being involved in smooth muscle relaxation and cell cycle control outside the lower urinary tract. Here, we investigated the expression and function of EPAC in human prostate tissues from patients undergoing radical prostatectomy. Results: mRNA and protein expression of EPAC was detected in all prostate tissues by RT-PCR and Western blot analysis. Immunoreactivity was observed in stromal cells, and colocalized with immunofluorescence for a-smooth muscle actin and calponin. Under normal conditions, noradrenaline-or phenylephrine-induced contraction of prostate strips in the organ bath was not affected by the EPAC activator pCPT (SP-8-pCPT-2'-O-Me-cAMPS.NA) (30 mu M). However, when the cyclooxygenase inhibitor indomethacin (50 mu M) was added, EPAC activators pCPT and OME (8-CPT-2'-O-Me-cAMP.Na) (30 mu M) significantly reduced contractions by low concentrations of phenylephrine. These effects were not observed on noradrenaline-induced contraction. OME and pCPT caused phosphorylation of the transcription factor Elk1 in prostate tissues. Elk1 activation was confirmed by EMSA (electrophoretic mobility shift assay), where OME and pCPT incresed Elk1 binding to a specific DNA probe. Conclusions: EPAC activation may reduce alpha 1-adrenergic prostate contraction in the human prostate, although this effect is masked by cyclooxygenases and beta-adrenoceptors. A main EPAC function in the human prostate may be the regulation of the transcription factor Elk1.
Fakultät für Biologie - Digitale Hochschulschriften der LMU - Teil 04/06
Early-life stress (ELS) can lead to enduring changes in the structure and function of neural circuits and endocrine pathways, resulting in altered vulnerability thresholds for stress-related disorders such as depression and anxiety. The question addressed in this work was whether epigenetic mechanisms contribute to the long-term programming of altered hypothalamus-pituitary-adrenal axis activity in ELS (maternal separated on postnatal days 1-10) mice. Adrenocorticotropic hormone (ACTH), a key pituitary mediator of the adrenocortical response to stress, is encoded by the proopiomelanocortin (Pomc) gene. Corticotropin releasing hormone (CRH) and arginine vasopressin (AVP) are the main upstream neural regulators of Pomc gene expression and the post-translational processing of its peptidergic products, whereas glucocorticoids, secreted by the adrenals in response to stress, exert negative feedback actions on Pomc synthesis and ACTH secretion. It was shown that Pomc mRNA level is persistently increased in ELS mice and leads to sustained hypersecretion of glucocorticoids. Interestingly, ELS causes a reduction in DNA methylation at a critical regulatory region of the Pomc gene; this occurs with some delay after onset of the stress and persists for up to 1 year. A series of experiments (including reporter-, EMSA-, IHC- and ChIP-assays) supported the concept that the adverse early-life event induces changes in Pomc gene methylation and results in persistently upregulated expression of the Pomc gene. Interestingly, stress-induced changes in DNA-methylation were found to be more pronounced in males than in females, raising the possibility that epigenetic encoding occurs in a sex-specific manner; this may help to explain sex differences in susceptibility to stress-related disorders. Collectively, the results of this study indicate that epigenetic mechanisms can serve to translate environmental cues into stable changes (“cellular memory”) in gene expression in post-mitotic tissues, without the need for alterations in the genetic code.
The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.
Medizinische Fakultät - Digitale Hochschulschriften der LMU - Teil 09/19
In den vergangenen Jahren ist es gelungen mittels verbesserter Fahrzeugtechniken, verkürzten Rettungszeiten und verbesserten Primärversorgungskonzepten, sowie standardisiertem Schockraum-Management und kontinuierlich optimierter intensivmedizinischer Behandlung, etc. die frühe Mortalität nach schwerem Polytrauma zu senken. Immer weniger Patienten versterben somit an den direkten Traumafolgen. Im weiteren Verlauf jedoch versterben noch immer bis zu 30 % an den Folgen eines posttraumatischen MOF. Somit stellt dieses immunologische Phänomen die schwerwiegendste Komplikation nach Polytrauma dar. In diesem Zusammenhang haben verschiedene Autoren versucht, jene Faktoren und Mechanismen zu identifizieren, die den Organismus dazu bewegen, seine eigenen, von dem initialen Trauma nicht betroffenen Organe zu zerstören. Jüngste Veröffentlichungen geben starke Hinweise darauf, dass der gefürchteten Ausbildung einer posttraumatischen Immunsystemdysfunktion mit konsekutivem Organversagen die Fehlfunktion immunkompetenter Zellen (Monozyten, Granulozyten) vorausgeht. Ferner sind intrazelluläre Netzwerke zahlreicher pro- und antiinflammatorischer Mediatoren, die in komplexen Verkettungen miteinander interagieren, daran beteiligt. Die intrazellulären Steuerungsmechanismen, die diese Fehlfunktion induzieren und regulieren, sind bislang jedoch weitgehend unerforscht. Zahlreiche Studien belegen, dass insbesondere Zytokine und ihre Signaltransduktionskaskaden an der Immunantwort beteiligt sind. Deren initiierende Steuerung ist jedoch weitgehend unbekannt. Von besonderer Bedeutung sind in diesem Zusammenhang die Transkriptionsfaktoren, da diese über die Expression von Reporter- und Effektorgenen entscheiden und sowohl hemmende als auch aktivierende Effekte ausüben können. Zahlreiche Untersuchungen weisen auf die Bedeutung der Signal Transducer and Activator of Transcription (STAT) Proteine in Inflammationsreaktionen hin. Bislang liegen jedoch noch keine Daten über die Aktivierung von STAT1 und STAT3 in immunkompetenten Zellen polytraumatisierter Patienten vor. Kenntnisse dieser Aktivität wären jedoch klinisch von essentieller Bedeutung für das Verständnis der posttraumatischen Immunreaktion und für die Entwicklung potentieller innovativer Therapiestrategien. Ziel der vorliegenden Arbeit war es daher, die DNA-Bindungsaktivität dieser Transkriptionsfaktoren in Monozyten und Granulozyten von Normalprobanden und schwerst verletzten Patienten in der initialen Phase nach Polytrauma zu analysieren und die Ergebnisse mit den klinischen Parametern wie Überleben, Verletzungsschwere und erhaltener Massentransfusion zu vergleichen. Zu diesem Zweck wurden polytraumatisierte Patienten mit einem Injury Severity Score größer 16 Punkten eingeschlossen. Die Blutabnahmen erfolgten zu festgelegten Abnahmezeitpunkten, nämlich initial nach Trauma und nach 6, 12, 24, 48 und 72h. Wobei die Initialabnahme innerhalb der ersten 90min nach Trauma erfolgte. Zur Zellisolation wurden aus dem entnommenen EDTA-Vollblut mittels positiven cell-sortings durch magnetische AK-Markierung CD-14 positive Monozyten und CD 15 positive Granulozyten isoliert. Das nukleäre Protein aus diesen wurde radioaktiv markiert und mittels EMSA elektrophoretisch aufgetrennt um so die DNA-Bindungsaktivität von STAT3 und STAT1 quantitativ nachzuweisen. Zusätzlich wurden Monozyten und Granulozyten gesunder Normalprobanden als Negativkontrolle bzw. mit LPS stimuliert als Positivkontrolle untersucht. Die Ergebnisse zeigen die DNA Bindungsaktivität von STAT1 und STAT3 in den Normalprobanden signifikant erhöht nach LPS Stimulation. Bei den Patienten konnte in beiden Zellpopulationen eine erhöhte Aktivität von STAT1 und STAT3 im Vergleich zur Nativkontrolle detektierte werden. Die Aufteilung des Kollektivs hinsichtlich klinischer Parameter wie outcome, Verletzungsschwere und erhaltener Massentransfusion zeigt, dass Patienten mit einem schlechteren klinischen Verlauf eine Reduktion der Aktivität von STAT1 und STAT3 in beiden Zellpopulationen aufweisen. Die vorgelegten Ergebnisse sind eine erstmalige Analyse der intranukleären DNA-Bindungsaktivität von STAT1 und STAT3 in polytraumatisierten Patienten in der direkt posttraumatischen Phase. Die frühe Induktion der Bindungsaktivität in Monozyten und Granulozyten im gesamten Kollektiv weist auf die beginnende systemische Entzündungsreaktion hin, und die Reduktion in massentransfundierten bzw. verstorbenen Patienten auf die bereits postulierte Unfähigkeit des Immunsystems, nach schwererer Verletzung adäquat zu reagieren. Die Daten sind Grundlage weiterer Folgeuntersuchungen wobei insbesondere die Frage nach der biologischen Relevanz mittels Reportergenexpression untersucht werden sollte.
V-B) Regolazione della trascrizione negli eucarioti Prof. Vincenzo De Simone Dott.ssa Luisa
V-A) Le tre RNA polimerasi eucariotiche ed i relativi promotori Prof.
IV-C) I saggi EMSA e DNAse I footprinting Prof. Vincenzo De
Naftatõrje valmisoleku suurendamine Soome lahel Eestimaa Looduse Fondi uuringutes. Eesti Lootsi uued kaatrid võimaldavad meresõitu talveks pikendada. Allveeuuringud Juminda poolsaare juures miiniväljadel. Mis on Eesti Meremeeste Sõltumatu Ametiühingu (EMSA) laevapere fond? Saatejuht on Hubert Veldermann. (Hubert Veldermann)
Fakultät für Biologie - Digitale Hochschulschriften der LMU - Teil 02/06
RBP-Jκ serves as interaction partner for both cellular and viral proteins. The protein mediates cellular and Epstein-Barr viral signal transduction, which in both cases results in dedifferentiation or immortalization of the cell. The intracellular part of the human Notch1 protein (Notch-IC) and of the Epstein-Barr viral protein EBNA2 binds to RBP-Jκ and expels a corepressor complex to activate transcription. The two proteins have similar functions and their binding regions on RBP-Jκ lie in close vicinity or partially overlap. An important step towards a better understanding of the biology of both signal transduction pathways is to find differences in the properties of Notch and EBNA2, such as binding affinities, stability or binding sites on RBP-Jκ. The aim of the present work was therefore to characterize the interaction of RBP-Jκ with DNA, proteins and relevant peptides using biochemical, biophysical and structural methods. Expression and purification protocols were developed, which enabled us to obtain sufficiently large amounts of each complex partner. A high biological activity of the individual components was obtained by using different expression systems. After the characterization of RBP-Jκ expressed in different systems and of potentially more soluble truncations, which may be easier to crystallize, using EMSA and CD spectroscopy, all subsequent studies were carried out with recombinant RBP-Jκ proteins obtained from insect cells. In comparison with RBP-Jκ proteins expressed in bacteria, these had a higher affinity for DNA as well as for Notch proteins. In contrast, according to EMSA, a high biological activity of Notch and EBNA2 proteins expressed in bacteria was found. There is some controversy in the literature concerning the parts of Notch-IC involved in the binding to RBP-Jκ. The detailed characterization of the interaction of RBP-Jκ with the strongest interacting component, NotchRam, and the naturally occurring fusion of Ram with seven ankyrin repeats, NotchRamANK, using isothermal titration calorimetry (ITC), EMSA and small angle x-ray scattering with binary and ternary complexes allowed us to create models, which unambiguously exclude the participation of the ankyrin repeats in the binding of RBP-Jκ in a system consisting only of the highly purified components of the complex. CD spectroscopy revealed that free Ram is largely unfolded and folds into largely α-helical structures upon binding to RBP-Jκ. Cell biological methods usually provide indirect information about interactions but do not provide quantitative data regarding the strength. The controlled reaction systems developed in the present study enabled us to detect a 20- to 50-fold higher affinity of EBNA291-355 for RBP-Jκ compared to NotchRamANK. Interestingly, first results indicate that the CR6 region of EBNA2, which is described as the most important region interacting with RBP-Jκ cannot account for the higher affinity. A precise description of the binding sites of the interaction partners would require crystals of RBP-Jκ in complex with proteins from Notch-IC and/or DNA. The many attempts at obtaining suitable crystals were hitherto unsuccessful although we were able to narrow down the area of likely crystallization conditions. The results obtained by different methods help to clarify the role of the interaction partners of RBP-Jκ in the context of infections by the Epstein-Barr virus, which may lead to malignant tumours because of both the similarities and functional differences of Notch and EBNA2. Furthermore, with the results of the present study the discussion of whether a therapeutic attack on the level of the RBP-Jκ-EBNA2 interaction is useful has to be resumed.
Fakultät für Biologie - Digitale Hochschulschriften der LMU - Teil 02/06
Two inbred rat lines have been developed that show either high (HAB) or low (LAB) anxiety-related behavior. The behavioral phenotype correlates with arginine vasopressin (AVP) expression at the level of the hypothalamic paraventricular nucleus (PVN), but not supraoptic nucleus, with HAB animals overexpressing the neuropeptide in both magnocellular and parvocellular subdivisions of the PVN. This study aimed to investigate the molecular cause of the AVP overexpression in the PVN of the HAB animals. Sequencing of the AVP locus resulted in the detection of a number of single nucleotide polymorphisms (SNPs) in the promoter differing between the HAB and LAB animals. Two of the SNPs were embedded in cis-regulatory elements. Genotyping further revealed that the HAB-specific allele of the AVP gene promoter occurs in 1.5% of outbred Wistar rats. An assay was developed to address the question of differential allele-specific transcription rates between the LAB and HAB alleles using cross-mated HAB/LAB F1 animals. Results from the experiment revealed the HAB AVP promoter to be more transcriptionally active in vivo. EMSA assays confirmed that one specific SNP [A(-1276)G] conferred reduced binding of the transcriptional repressor CArG binding factor A (CBF-A) in the HAB allele. Reporter gene assays supported the view that the A(-1276)G transition in the CArG element impairs CBF-A repression in the HAB allele, which in turn relates to a weakened repression of the intact HAB AVP promoter by CBF-A. Furthermore, CBF-A is highly co-expressed in AVP-containing neurons of the PVN supporting an important role for regulation of AVP gene expression in vivo. Taken together, these results demonstrate a role for an AVP gene polymorphism and CBF-A in elevated AVP expression in the PVN of HAB rats likely to contribute to their behavioral and neuroendocrine phenotype. Phenotypic variation among organisms is central to evolutionary adaptations underlying natural and artificial selection, and also determines individual susceptibility to common diseases including cardiovascular, metabolic and age related and psychiatric diseases. Most phenotypic diversity in natural populations is characterised by differences in degree rather than in kind. In accordance with this view, HAB rats lacked changes in the coding part of the vasopressin gene, but instead were homozygous for the polymorphic promoter region. Therefore, the HAB specific AVP promoter represents a natural model for AVP overexpression and highlights, in turn, cognate molecular pathways which potentially fuel the resulting pathologies. Specifically, our finding that the SNP in position 1276 of the AVP gene promoter underlies AVP overexpression in the PVN of HAB rats, makes this SNP a potential target for further studies aimed at improving therapeutic tools. Finally, further studies are necessary to understand to which degree and in concert with which vulnerability loci vasopressin overexpression underlies the complex neuroendocrine and behavioural stigmata in the HAB line. Certainly, such studies will yield important insights into gene-gene interactions between susceptibility genes and shed light on additional pathways suitable for therapeutic interventions. In conclusion, this present work exemplifies that selective inbreeding for behavioural traits and combined phenotypic and molecular analysis of candidate genes is an important step and tool to address these issues.
Background: Bile acid-induced apoptosis in hepatocytes can be antagonized by NF-κBdependent survival pathways. Sulfasalazine modulates NF-κB in different cell types. We aimed to determine the effects of sulfasalazine and its metabolites sulfapyridine and 5-aminosalicylic acid (5-ASA) on bile acid-induced apoptosis in hepatocytes. Methods: Apoptosis was determined by caspase assays and immunoblotting, NF-κB activation by EMSA and reporter gene assays, generation of reactive oxygen species (ROS) fluorometrically, bile secretion gravimetrically and bile acid uptake radiochemically and by gaschromatography in HepG2-Ntcp cells and isolated perfused rat livers. Results: Glycochenodeoxycholic acid (GCDCA, 75μmol/L)-induced apoptosis was reduced by sulfasalazine dose-dependently (1-1000 μmol/L) in HepG2-Ntcp cells, whereas its metabolites 5- ASA and sulfapyridine had no effect. Sulfasalazine significantly reduced GCDCA-induced activation of caspases 9 and 3. In addition, sulfasalazine activated NF-κB, and decreased GCDCA-induced generation of ROS. Bile acid uptake was competetively inhibited by sulfasalazine. In perfused rat livers, GCDCA (25 μmol/L)-induced liver injury and extensive hepatocyte apoptosis were significantly reduced by simultaneous administration of 100 μmol/L sulfasalazine: LDH and GPT activities were reduced by 82% and 87%, respectively, and apoptotic hepatocytes were observed only occasionally. GCDCA uptake was reduced by 45±5% when sulfasalazine was coadministered. However, when 50% of GCDCA (12.5 μmol/L) were administered alone, marked hepatocyte apoptosis and liver injury were again observed questioning the impact of reduced GCDCA uptake for the antiapoptotic effect of sulfasalazine. Conclusion: Sulfasalazine is a potent inhibitor of GCDCA-induced hepatocyte apoptosis in vitro and in the intact liver.
Fakultät für Chemie und Pharmazie - Digitale Hochschulschriften der LMU - Teil 02/06
Regulation of gene expression takes place in the nucleus in a highly structured and condensed nucleoprotein environment, called chromatin (Felsenfeld and Groudine, 2003; Khorasanizadeh, 2004; Vaquero et al., 2003). A broad group of factors regulates the properties of chromatin; e.g. by covalently modifying histones and / or by ATP-dependent chromatin remodeling, thereby allowing or preventing gene expression. The mammalian genome contains hundreds of gene copies encoding precursor ribosomal RNA and the transcription of these genes is highly regulated with respect to cellular metabolism (Grummt, 2003). However, even in actively growing cells, only a subset of the rRNA genes are actively transcribed, exhibiting an accessible chromatin conformation (Conconi et al., 1989). In a chromatin context, the activation of rDNA genes involves the transcription termination factor TTF-I (Längst et al., 1998; Längst et al., 1997a). However, the silenced rDNA gene fraction remains in an inaccessible heterochromatic state throughout the cell cycle (Conconi et al., 1989). Until recently, the onset of silencing and the mechanisms that maintain the inactive state of rRNA genes were less understood. Recent studies, including the work presented in this thesis, provide insights into the molecular mechanism of ribosomal RNA gene silencing (Lawrence et al., 2004; Németh et al., 2004; Santoro and Grummt, 2001; Santoro et al., 2002; Strohner et al., 2004; Zhou et al., 2002). Accumulating evidence indicates that the combined action of chromatin modifying mechanisms such as chromatin remodeling, histone modification and DNA methylation contribute to the process of rRNA gene silencing. Here I present data demonstrating an active role of the chromatin remodeling complex NoRC in rDNA gene silencing and propose dual functions of TTF-I in rDNA regulation in chromatin, namely involvement in both activation and silencing of rDNA transcription. 4.1 NoRC, a novel chromatin remodeling complex In this doctoral study, a novel protein complex, composed of the nucleolar protein Tip5 and the ATPase Snf2h, was purified using convential chromatography and affinity purification methods. A detailed chromatin remodeling analysis revealed that this complex is able to induce mononucleosome movement in an ATP and histone H4 tail dependent fashion. Finally, this Tip5-Snf2h complex was termed NoRC (nucleolar remodeling complex), a novel member of the ISWI family of ATP-dependent chromatin remodeling complexes (Strohner et al., 2001). To dissect its functions, the NoRC complex was reconstituted from its recombinant subunits Tip5 and Snf2h, using the baculo virus driven expression system. Reconstitution confirmed the direct interaction between Tip5 and Snf2h. Furthermore, recombinant and cellular NoRC display similar sizes in gel filtration columns. Recombinant NoRC exhibits chromatin stimulated ATPase activity and mobilizes nucleosomes in an energy-dependent manner. Both activities are histone H4 tail dependent. NoRC and its subunits Tip5 and Snf2h were compared in different DNA / Nucleosome binding assays. NoRC shows preferred binding to structured (bent) DNA, e.g. a region within the mouse rDNA promoter, and interacts with mononucleosomes in electrophoretic mobility shift assays (EMSA). While no stable interaction with core nucleosomes could be detected in EMSA, ATPase assays and DNase I protection assays noticeably pinpointed to NoRC / nucleosome interactions with both nucleosomal and protruding linker DNA. 4.2 NoRC specifically represses rDNA transcription in chromatin The functional consequences of the Tip5 / TTF-I interaction were assessed and the influence on chromatin structure of the rDNA promoter in an in vitro system was determined. Tip5 in NoRC interacts with the N-terminal part of full length TTF-I and unmasks its DNA binding site. This interaction is required both for binding of TTF-I to its promoter-proximal target site and for the recruitment of NoRC to the promoter in chromatin. After association with the rDNA promoter, NoRC alters the position of the promoter-bound nucleosome. To elucidate a potential role of NoRC in rDNA transcriptional regulation, we used an in vitro transcription system with an rDNA minigene reconstituted into chromatin. These studies revealed a specific function for NoRC in rDNA transcriptional repression on chromatin templates. In contrast, NoRC had no effect on DNA transcription. Transcription experiments were then performed with chromatin templates reconstituted from recombinant histones lacking individual histone tails. The results indicate that NoRC-mediated rDNA gene repression is dependent on the histone H4 tail, suggesting an involvement of chromatin remodeling. Further transcription experiments revealed that NoRC-mediated repression occurs prior to preinitiation complex formation and does not affect activated rDNA genes. NoRC stably associates with the silenced gene, and these early steps of rDNA repression do not depend on DNA and histone modifications (Strohner et al., 2004). NoRC showed preferred binding to a structured (bent) region within the mouse rDNA promoter. Methylation of a single CpG dinucleotide within this region abrogated rDNA transcription in chromatin (Santoro and Grummt, 2001), but did not influence DNA binding of NoRC. Furthermore, nucleosomal DNA is less methylated than free DNA, but chromatin remodeling enhances methylation. The results suggest an important role for the chromatin remodeling complex NoRC in the establishment of rDNA silencing. NoRC then contributes to maintenance of the silenced state throughout the cell cycle by interacting with DNA and histone modifying enzymes. Transcriptional repression by chromatin remodeling factors seems to be a common mechanism to stably inhibit gene expression.