Catecholamine hormone and neurotransmitter
POPULARITY
Nutrition Nugget! Bite-sized bonus episodes offer tips, tricks and approachable science. This week, Jenn is talking about Senobi breathing, a Japanese breathing technique that headlines are claiming can help you lose weight. The buzz is based on a 2010 study from Japan that found some pretty compelling hormonal and body-composition changes in participants who practiced this simple one-minute exercise three times a day. Could a few deep breaths in a specific posture really shift your metabolism, activate your nervous system, and burn body fat? Jenn digs into the actual study, breaks down what Senobi breathing is, why it might work, and what the science does and does not actually tell us. She sees the intrigue, but does she buy it? Like what you're hearing? Be sure to check out the full-length episodes of new releases every Wednesday. Have an idea for a nutrition nugget? Submit it here: https://asaladwithasideoffries.com/index.php/contact/ RESOURCES:Become a Happy Healthy Hub MemberJenn's Free Menu PlanA Salad With a Side of FriesA Salad With A Side Of Fries MerchA Salad With a Side of Fries InstagramTick…Tick…BOOMKEYWORDS: Jenn Trepeck, Nutrition Nugget, Salad With A Side Of Fries, Health Tips, Wellness Tips, Breathwork and Metabolism, Senobi Breathing Weight Loss, Senobi Breathing, Breathing Technique For Weight Loss, Japanese Breathing Exercise, Sympathetic Nervous System, Parasympathetic Nervous System, Fight Or Flight Response, Noradrenaline, Breathwork And Metabolism, Deep Breathing Benefits, Nervous System Balance, Body Fat Percentage, BMI, Stress Response, Rest And Digest, Brown Fat Activation, Basal Metabolic Rate, Posture And Metabolism, Thoracic Spine Breathing, Scapula Position, Breathing Before Meals, Habit Stacking, Eustress, Good Stress, Heart Rate Variability, Urinary Hormone Secretion, Estradiol, Growth Hormone, Abdominal Breathing, Chest Opening, Weight Loss Tips, Natural Weight Loss, Hormone Balance, Wellness Podcast, Nutrition Nugget, Breathing Exercises For Women, Metabolic Health, Mind Body Connection, Stress And Weight Gain, Breathing And Cortisol, Women Over 40 Weight Loss, Japanese Breathing Exercise For Weight Loss Women Over 40, Does Senobi Breathing Help Lose Body Fat
What Is the Safest Metabolism Booster? It's free, and causes the adrenal hormone noradrenaline to surge in your bloodstream, as if you just smoked a few cigarettes or had a few cups of coffee. Listen to today's episode written by Dr. Michael Greger at @NutritionFacts.org #vegan #plantbased #plantbasedbriefing #water #h20 #hydrate #metabolism #noradrenaline #ephedra ============================ Original post: https://nutritionfacts.org/video/friday-favorites-what-is-the-safest-metabolism-booster/ ============================ Dr. Michael Greger is a physician, New York Times bestselling author, and internationally recognized speaker on nutrition, food safety, and public health issues. A founding member and Fellow of the American College of Lifestyle Medicine, Dr. Greger is licensed as a general practitioner specializing in clinical nutrition. He is a graduate of the Cornell University School of Agriculture and Tufts University School of Medicine. He founded NUTRITIONFACTS.ORG is a non-profit, non-commercial, science-based public service provided by Dr. Michael Greger, providing free updates on the latest in nutrition research via bite-sized videos. There are more than a thousand videos on nearly every aspect of healthy eating, with new videos and articles uploaded every day. His latest books —How Not to Die, the How Not to Die Cookbook, and How Not to Diet — became instant New York Times Best Sellers. His two latest books, How to Survive a Pandemic and the How Not to Diet Cookbook were released in 2020. 100% of all proceeds he has ever received from his books, DVDs, and speaking engagements have always and will always be donated to charity. ============================== FOLLOW THE SHOW ON: YouTube: https://www.youtube.com/@plantbasedbriefing Spotify: https://open.spotify.com/show/2GONW0q2EDJMzqhuwuxdCF?si=2a20c247461d4ad7 Apple Podcasts: https://podcasts.apple.com/us/podcast/plant-based-briefing/id1562925866 Your podcast app of choice: https://pod.link/1562925866 Facebook: https://www.facebook.com/PlantBasedBriefing LinkedIn: https://www.linkedin.com/company/plant-based-briefing/ Instagram: https://www.instagram.com/plantbasedbriefing/
The Psychology of Self-Injury: Exploring Self-Harm & Mental Health
Does the emotion someone experiences immediately preceding an episode of nonsuicidal self-injury (NSSI) influence how painful that episode of self-harm feels? In this episode, Michelle Hiner, MS, a Clinical Psychology PhD student in the Emotion and Psychopathology (EmP) Lab at Rutgers University in New Jersey talks about how individuals who self-harm after experiencing high arousal negative emotions (HANEs), like anger, experience pain differently than those who self-injure after experiencing low arousal negative emotions (LANEs), like sadness and dissociation. Connect with Michelle on LinkedIn here, and learn more about the Emotion and Psychopathology (EmP) Lab here. Below are some papers referenced in this episode:Drummond, P. D. (1995). Noradrenaline increases hyperalgesia to heat in skin sensitized by capsaicin. Pain, 60(3), 311-315.Wiercioch-Kuzianik, K., & Bąbel, P. (2019). Color hurts. The effect of color on pain perception. Pain Medicine, 20(10), 1955-1962.Paul, E., Tsypes, A., Eidlitz, L., Ernhout, C., & Whitlock, J. (2015). Frequency and functions of non-suicidal self-injury: Associations with suicidal thoughts and behaviors. Psychiatry Research, 225(3), 276–282.Want to have a bigger role on the podcast?:Should you or someone you know be interviewed on the podcast? We want to know! Please fill out this Google doc form, and we will be in touch with more details if it's a good fit.Want to hear your question and have it answered on the podcast? Please send an audio clip of your question (60 seconds or less) to @DocWesters on Instagram or Twitter/X, or email us at thepsychologyofselfinjury@gmail.comWant to be involved in research? Send us a message at thepsychologyofselfinjury@gmail.com and we will see if we can match you to an active study.Want to interact with us through comments and polls? You can on Spotify!Follow Dr. Westers on Instagram and Twitter/X (@DocWesters). To join ISSS, visit itriples.org and follow ISSS on Facebook and Twitter/X (@ITripleS).The Psychology of Self-Injury podcast has been rated as one of the "10 Best Self Harm Podcasts" and "20 Best Clinical Psychology Podcasts" by Feedspot and one of the Top 100 Psychology Podcasts by Goodpods. It has also been featured in Audible's "Best Mental Health Podcasts to Defy Stigma and Begin to Heal." Goodpods Top 100 Parents Podcasts Listen now to The Psychology of Self-Injury: ExploringSelf-Harm & Mental Health podcast Goodpods Top 100 Research Podcasts Listen now to The Psychology of Self-Injury: ExploringSelf-Harm & Mental Health podcast
(7 september staat al weer de 4e editie van het AD(H)D-ervaringsevent gepland. Ben jij erbij? Klik hier voor meer informatie!: https://jasperbuitenhuis.nl/het-adhd-ervaringsevent/) Neurotransmitters, je hoort en leest er veel over. De neurotransmitters dopamine en noradrenaline spelen een grote rol bij de symptomen van ADD/ADHD. Maar wat zijn neurotransmitters nou eigenlijk? En wat is de functie van dopamine en noradrenaline? Hoe kun jij zelf op een natuurlijke manier deze neurotransmitters aanmaken? Wil jij leren hoe zelf invloed hebt op je brein en daarmee dus ook op je AD(H)D symptomen? Dan is dit de perfecte aflevering. Heel veel luisterplezier!
This is episode 5 of a 6-part special series on sleep with Dr. Matthew Walker, Ph.D., a professor of neuroscience and psychology at the University of California, Berkeley and the host of The Matt Walker Podcast. In this episode, we explain the connection between sleep and improved mood, emotional regulation and mental well-being. We explain the role of rapid eye movement (REM) sleep in processing emotions and memories and why sleep deprivation causes feelings of agitation, impulsivity and emotional reactivity. We also discuss why disrupted sleep is a hallmark feature of PTSD, anxiety, depression, suicidality, and other psychiatric conditions. We explain protocols for improving REM sleep and other sleep phases in order to harness the therapeutic power of quality sleep to feel calm and emotionally restored. This episode describes many actionable tools to improve sleep for those struggling with specific mental health issues or for anyone wanting to bolster overall mental well-being. The next episode in this special series explores dreams, including lucid dreaming, nightmares and dream interpretation. For show notes, including referenced articles and additional resources, please visit hubermanlab.com. Thank you to our sponsors AG1: https://drinkag1.com/huberman Eight Sleep: https://eightsleep.com/huberman LMNT: https://drinklmnt.com/huberman BetterHelp: https://betterhelp.com/huberman InsideTracker: https://insidetracker.com/huberman Momentous: https://livemomentous.com/huberman Timestamps (00:00:00) Sleep & Mental Health (00:01:09) Sponsors: Eight Sleep, LMNT & BetterHelp (00:05:14) Emotions & Sleep, Amygdala (00:17:27) Emotional Memory & Sleep (00:25:48) “Overnight Therapy” & REM Sleep, Noradrenaline (00:29:13) Sponsor: AG1 (00:30:27) Sleep to “Remember & Forget”, Trauma; REM Sleep (00:38:27) Hinge Analogy; Motivation, Impulsivity & Addiction (00:47:08) Tool: Improve REM Sleep, Social Jet Lag, Alcohol & THC, Addiction (00:56:18) Sponsor: InsideTracker (00:57:23) Post-Traumatic Stress Disorder (PTSD) & REM Sleep (01:06:53) Noradrenaline & REM Sleep, PTSD & Prazosin (01:09:40) Addiction, Non-Sleep Deep Rest (NSDR); Liminal States (01:16:46) Anxiety & Sleep, Mood vs. Emotions (01:23:50) Deep Non-REM Sleep & Anxiety, Sleep Quality (01:28:51) Tool: Improve Deep Non-REM Sleep, Temperature; Alcohol (01:34:56) Suicidality & Sleep, Pattern Recognition; Nightmares (01:46:21) Depression, Anxiety & Time Context (01:51:24) Depression, Too Much Sleep?; REM Changes & Antidepressants (01:57:37) Sleep Deprivation & Depression (02:01:34) Tool: Circadian Misalignment & Mental Health, Chronotype (02:04:05) Tools: Daytime Light & Nighttime Darkness; “Junk Light” (02:13:04) Zero-Cost Support, Spotify & Apple Reviews, Sponsors, YouTube Feedback, Momentous, Social Media, Neural Network Newsletter Disclaimer
Welcome to the 17th episode of The Brain Podcast - the official podcast of the journals Brain and Brain Communications. This episode features a discussion with senior author Dr Bénédicte Ballanger of the Brain article entitled: Noradrenergic alterations in Parkinson's disease: a combined 11C-yohimbine PET/neuromelanin MRI study Can this multi-modal study examining the role of Noradrenaline in Parkinson's disease offer insight into important neurotrasmitter pathophysiology and provide the basis for a non-dopamine therapeutic strategy? Check out the full article on the Brain website: https://doi.org/10.1093/brain/awad338 This episode was co-hosted by Andreas Themistocleous and Michael David, edited and produced by Michael David and Xin You Tai, co-produced by Antonia Johnston, original music by Ammar Al-Chalabi.
Don't think about having truly achieved sobriety until one year from the last acting out.“A bit arbitrary Gary. Rather too long, don't you think?” My reply is that the compulsive and addiction behaviours usually have a few decades start on you. In other words, many clients have been doing the behaviours for decades – often since childhood development. A habit; a hamster wheel behaviour pattern; otherwise more therapeutically called a neural pathway - is well established. It is not going to be possible to wean your brain – your physiology - off the biochemical fix of Dopamine, Oxytocin, Serotonin & Noradrenaline, in a short time frame. There is a “cold turkey” effect. It is not like illegal drugs. The cold turkey effect is mood related. That is what the addiction was set up to manage.And then that thing called “Insecure Attachment” again….Why not interact with me about these Podcasts. I don't know if you are getting benefit or not. Motivate me to keep going. Go on. Text/WhatsApp +447866097247; Email: info@kairos-centre.comPresented by The Kairos Centre: bit.ly/pornaddictionhelpThe Kairos Centre created probably the world's first comprehensive Online webinar Sex, Porn, Love Addiction video-on-demand Recovery Programme; where you discover the real, authentic you.Bringing colour back to life - without shame.Connect with me on Youtube: Gary McFarlanehttps://www.kairos-centre.com/changement-on-demand/Gary McFarlane BA, LLM, Dip, CertsNow launched: A Video-on-Demand Online Course (for Singles, Couples/Marrieds/Partners & long time marrieds) Gary is a Relate trained and experienced Relationship counsellor, Mediator and undertakes Sex Therapy & Sex Addiction treatment all of which are undertaken by various online secure webcam such as zoom & Bilateralbase, with clients worldwide. Gary has been working Online for some 11 years and holds a certificate in Online Therapy. He is also a member of the National Counselling Society, the Association for the Treatment of Sexual Addiction & Compulsivity (ATSAC) and an Accredited member of the Assoc of Christian Counsellors and is a member of stopSO. He also practices EMDR (Eye movement desensitization and reprocessing) as an Accredited EMDR Practitioner; AI-EMDR (Attachment Informed EMDR), Couples together EMDR (on each other); G-TEP (Group affected/impacted trauma EMDR), R-TEP (Recent Event EMDR) and The Advanced Flash Technique (to reduce emotional disturbance in less than 10 mins) - for Trauma, Anxiety, Stress, Depression, pain, fears and many more conditions - unprocessed issues from the past/decades or current.Email: info@kairos-centre.comwww.kairos-centre.comTel 0786 609 7247Social Media linksInstagram - https://www.instagram.com/thekairoscentre/Facebook - https://www.facebook.com/KairosTherapy/LinkedIn - https://www.linkedin.com/company/the-kairos-centreWebsite – https://www.kairos-centre.com/YouTube - https://www.youtube.com/@kairoscentreCOD - https://www.kairos-centre.com/changement-on-demand/Support the show
This is a powerful episode, its very raw and rather emotional but I have Aleisha Pienaar to guest who shares her story of her Dad who had a heart attack last year at the tender age of 53 and who was, after being revived, left fighting for his life in ICU. Aleisha had read my book "Relentless" and had attended one of my speeches where I talked about my Mum and Dad's stories, It was in her time of need that these stories became the catalyst for her to fight hard for her Dad. The ICU team were convinced her Dad would not wake up from the coma and that if he did, after having been without oxygen for 46 minutes, that his life would be not worth living and that the brain damage would be massive or he would be in a vegetative state. They were told they must take him off life support. Aleisha reached out and I encouraged her to fight, to be vigilant and not to give up when all others had. A couple of days after they were told to take him off life support her father incredibly, woke up and although his rehab was hard and rather long her Dad is now back full into life, working, exercising and enjoying his family again. I share too, my personal story of fighting for my Dad in ICU and how I was blocked at every turn from getting what I needed for him. Please note these are our very personal, real stories and your experiences may be very different but we want to share openly, the good, the bad and the very ugly of what we experienced and a message of empowerment and a message of not to give up too early. If I had my mum would also not be with us now. We hope by sharing this, we will help other families faced with similar situations, we also hope that it might initiate change in our system. I have a dream and that is to get a law change in NZ - to get "The Right to Try" law which is implemented in some states in the USA which basically says that if the doctors have no more answers and someone is dying that you can sign a waiver and try anything reasonable to save that person's life. I wanted that for my Dad, I was wanting intravenous vitamin C and thiamine as per the protocol of this study But I was blocked due to legal issues and I had to fight for 15 days against the ethics committee - all mind you, while my father was dying and they had nothing more to offer and while they were actively trying to get me to sign off on taking him off life support. I eventually won the right by finding a loophole that allowed Dad's GP to come in and administer it but by then he was in multiple organ failure and could die at any minute and despite that the very first infusion (which was only half of what I wanted) dropped his CRP in half, improved his kidney function and enabled them to take him of Noradrenaline but then we were blocked for 18 hours from getting him the next infusion and again the next infusion and by then - it was way too little and way too late and I was forced to take him off life support and they morphined him in front of my own eyes until he died. Now I am left not knowing if we had been allowed to do it from the very beginning whether his life could have been saved and quite openly I have been left severely traumatized from this experience. Some of the things I witnessed in there were horrifying, I don't and can't share all of what we went through but suffice to say I believe things could have been different had we been given a chance. BIO Aleisha and her husband, Emil, are based in Dunedin Otepoti, New Zealand. Aleisha is a full-time parent to two little girls, and Emil manages a rest home. They have a heart for people whose voices are not heard, and have invested time in humanitarian work in the Amazon Jungle, as well as local outreaches to those who struggle in their home city. With a strong mission-mindset, Aleisha and Emil are working towards creating more impact in their community. They have faced several medical challenges, including misdiagnosis of a now-irreversible medical condition, two miscarriages, as well as the very near loss of Aleisha's father to a heart attack. As a whanau, their desire is to raise awareness of complications in the medical field that can be addressed if caught early enough, and believe that if enough people are vulnerable and willing enough to share their story, we can see a change in the health care system that will bring a lot more happy endings. And now a summary of how your book and story helped us save my dad. Lisa spoke at a conference that Emil and I attended two years ago, sharing the story of how she rehabilitated her mother through determination, self-education, and persistence. In 2022, I found myself facing a similar situation, when my father suffered a catastrophic heart attack. In all the confusion and uncertainty, Lisa's story came to mind, and I knew I needed to get my hands on her book, "Relentless." I devoured the pages, reread my notes from the conference, and what I immediately saw was the importance of standing firm, comparmentalizing emotions, and taking the necessary steps to fight for my dad's right to live. After a few days, we were asked to consider turning off my father's life support. I wasn't willing to settle for that result, and insisted that he remain on life support until we were able to successfully wake him and assess his brain function. The very next day, my father woke safely from his coma, and responded to instructions the doctors gave him. After a month in ICU, dealing with multiple crises and complications, my father was healthy enough to come home. His brain function is perfect. A few months of physical therapy rebuilt his muscle mass. He is completely himself, and alive, thanks to Lisa sharing her story two years ago. We are so grateful! Health Optimisation and Life Coaching with Lisa Tamati Lisa offers solution focused coaching sessions to help you find the right answers to your challenges. Topics Lisa can help with: Lisa is a Genetics Practitioner, Health Optimisation Coach, High Performance and Mindset Coach. She is a qualified Ph360 Epigenetics coach and a clinician with The DNA Company and has done years of research into brain rehabilitation, neurodegenerative diseases and biohacking. She has extensive knowledge on such therapies as hyperbaric oxygen, intravenous vitamin C, sports performance, functional genomics, Thyroid, Hormones, Cancer and much more. Testing Options Comprehensive Thyroid testing DUTCH Hormone testing Adrenal Testing Organic Acid Testing Microbiome Testing Cell Blueprint Testing Epigenetics Testing DNA testing Basic Blood Test analysis She can help you navigate the confusing world of health and medicine and can advocate for you. She can also advise on the latest research and where to get help if mainstream medicine hasn't got the answers you are searching for whether you are facing challenges from cancer to gut issues, from depression and anxiety, weight loss issues, from head injuries to burn out. Book you consultation with Lisa Join our Patron program and support the show Pushing the Limits' has been free to air for over 8 years. Providing leading edge information to anyone who needs it. But we need help on our mission. Please join our patron community and get exclusive member benefits (more to roll out later this year) and support this educational platform for the price of a coffee or two You can join by going to Lisa's Patron Community Or if you just want to support Lisa with a "coffee" go to https://www.buymeacoffee.com/LisaT to donate $3 Lisa's Anti-Aging and Longevity Supplements Lisa has spent years curating a very specialised range of exclusive longevity, health optimising supplements from leading scientists, researchers and companies all around the world. This is an unprecedented collection. The stuff Lisa wanted for her mum but couldn't get in NZ. Check out the range at her LongLifeLabs shop Subscribe to our popular Youtube channel with over 600 videos, millions of views, a number of full length documentaries, and much more. You don't want to miss out on all the great content on our Lisa's youtube channel. Youtube Order Lisa's Books Lisa has published 5 books: Running Hot, Running to Extremes, Relentless, What your oncologist isn't telling you and her latest "Thriving on the Edge" Check them all out at https://shop.lisatamati.com/collections/books Perfect Amino Supplement by Dr David Minkoff Introducing PerfectAmino PerfectAmino is an amino acid supplement that is 99% utilised by the body to make protein. PerfectAmino is 3-6x the protein of other sources with almost no calories. 100% vegan and non-GMO. The coated PerfectAmino tablets are a slightly different shape and have a natural, non-GMO, certified organic vegan coating on them so they will glide down your throat easily. Fully absorbed within 20-30 minutes! No other form of protein comes close to PerfectAminos Listen to the episode with Dr MInkoff here: Ketone Products by HVMN The world's best exogenous Ketone IQ Listen to the episode with Dr Latt Mansor Lisa's ‘Fierce' Sports Jewellery Collection For Lisa's gorgeous and inspiring sports jewellery collection, 'Fierce', go to Jewellery For Vielight Device Vielight brain photobiomodulation devices combine electrical engineering and neuroscience. To find out more about photobiomodulation, current studies underway and already completed and for the devices mentioned in this video go to www.vielight.com Use code "tamati" at checkout to get a 10% discount on any of their devices. Enjoyed This Podcast? If you did, subscribe and share it with your friends! If you enjoyed tuning in, then leave us a review and share this with your family and friends. Have any questions? You can contact my team through email (support@lisatamati.com) or find me on Facebook, Twitter, Instagram and YouTube. For more episode updates, visit my website. You may also tune in on Apple Podcasts. To pushing the limits, Lisa and team
Noradrenaline (norepinephrine) is a neurotransmitter and hormone that plays a role in the body's "fight or flight" response. Acetylcholine is a neurotransmitter (“brain” +” across” + “to send”) that helps transmit signals in the brain and body. Its name comes from its chemical structure, an acetate group and a choline molecule. Dopamine is a neurotransmitter that plays a role in motivation, reward, and movement. Its name comes from its chemical structure, a combination of two molecules called dihydroxyphenylalanine and dopamine. Adrenaline (epinephrine) is a hormone and neurotransmitter that helps the body respond to stress. Its name comes from its source, the adrenal glands. Serotonin is a neurotransmitter that is involved in mood, appetite, and sleep. Its name comes from its chemical structure, a combination of sero- (meaning "serum") and -tonin (meaning "tonic" or "substance that modifies"). Corticotropin-releasing hormone (CRH) is a hormone that stimulates the release of cortisol, a stress hormone. The name comes from its function of stimulating the release of corticotropin, a hormone that stimulates the adrenal glands. Also, it gets its name from its role in stimulating the release of adrenocorticotropic hormone (ACTH) from the pituitary gland, which in turn stimulates the release of cortisol from the adrenal gland. Vasopressin is a hormone that regulates water balance in the body. Its name comes from its ability to constrict blood vessels (vasoconstriction) and increase blood pressure. Vasopressin, also known as antidiuretic hormone (ADH), is so named because it regulates water balance by causing the kidneys to reabsorb water. Thyrotropin-releasing hormone (TRH) is a hormone that stimulates the release of thyroid-stimulating hormone (TSH), which regulates the thyroid gland. Its name comes from its function of stimulating the release of thyrotropin. Oxytocin is a hormone that is involved in social bonding, childbirth, and lactation. Its name comes from its ability to stimulate uterine contractions (oxytocic) and milk ejection (lactogenic). Gonadotropin-releasing hormone (GnRH) is a hormone that stimulates the release of luteinizing hormone (LH) and follicle-stimulating hormone (FSH), which regulate the reproductive system. Its name comes from its function of stimulating the release of gonadotropins. Growth hormone–releasing hormone (GHRH) is a hormone that stimulates the release of growth hormone (GH), which regulates growth and metabolism. Its name comes from its function of stimulating the release of growth hormone. Catecholamines are a group of hormones and neurotransmitters that includes adrenaline, noradrenaline, and dopamine. Their name comes from their chemical structure, which includes a catechol group and an amine group. Histamine is a neurotransmitter and hormone that is involved in inflammation, allergies, and gastric acid secretion. ACTH (adrenocorticotropic hormone) is a hormone that stimulates the release of cortisol from the adrenal glands. Orexin (hypocretin) is a neurotransmitter that is involved in wakefulness and appetite. Its name comes from its discovery in the hypothalamus and its ability to stimulate food intake (orexigenic). Glutamic acid (glutamate) is a neurotransmitter that is involved in learning, memory, and neural plasticity. Its name comes from its chemical structure, a combination of glutamine and an acid group. Galanin is a neuropeptide that is involved in pain perception, mood, and appetite. Its name comes from its discovery in the galanin-containing neurons of the hypothalamus. Neurotensin comes from the words "neuro," meaning related to nerves, and "tensin," which refers to its ability to cause contraction in smooth muscle. Neurotensin is a neuropeptide that is found in the central nervous system and gastrointestinal tract. --- Support this podcast: https://podcasters.spotify.com/pod/show/liam-connerly/support
Link to bioRxiv paper: http://biorxiv.org/cgi/content/short/2023.03.06.531292v1?rss=1 Authors: Larsen, L. E., Caestecker, S., Stevens, L., van Mierlo, P., Carrette, E., Boon, P., Vonck, K., Raedt, R. Abstract: The locus coeruleus (LC), a brainstem nucleus, is the sole source of noradrenaline in the neocortex, hippocampus and cerebellum. Noradrenaline is a powerful neuromodulator involved in the regulation of excitability and plasticity of large-scale brain networks. In this study, we assessed the activity of locus coeruleus neurons and changes in noradrenergic transmission during acute hippocampal seizures evoked with perforant path stimulation. LC neurons were recorded in anesthetized rats using a multichannel electrophysiology probe and were identified based on electrophysiological characteristics or optogenetic tagging. The majority of LC neurons (55%) were inhibited during seizures, while only a subset of LC neurons (28%) was excited during seizures. Topographic analysis of multi-unit activity showed anatomical separation of neurons that were excited and inhibited during seizures. Changes in hippocampal noradrenaline transmission during seizures were assessed using a fluorescent biosensor for noradrenaline, GRABNE2m, in combination with fiber photometry in both anesthetized and awake rats. Our results indicate that acute electrically evoked hippocampal seizures are associated with strong changes in LC unit activity and strong and consistent time-locked release of noradrenaline. Understanding the role of mass release of noradrenaline during hippocampal seizures is likely to be important to understand seizure pathophysiology. Copy rights belong to original authors. Visit the link for more info Podcast created by Paper Player, LLC
Link to bioRxiv paper: http://biorxiv.org/cgi/content/short/2023.02.02.526661v1?rss=1 Authors: Privitera, M., von Ziegler, L. M., Floriou-Servou, A., Duss, S. N., Zhang, R., Leimbacher, S., Sturman, O., Waag, R., Roessler, F., Heylen, A., Vermeiren, Y., Van Dam, D., De Deyn, P. P., Bohacek, J. Abstract: Exposure to an acute stressor triggers a complex cascade of neurochemical events in the brain. However, deciphering their individual impact on stress-induced molecular changes remains a major challenge. Here we combine RNA-sequencing with selective pharmacological, chemogenetic and optogenetic manipulations to isolate the contribution of the locus coeruleus - noradrenaline (LN-NA) system to the acute stress response. We reveal that NA-release during stress exposure regulates a large and reproducible set of genes in the dorsal and ventral hippocampus via {beta}-adrenergic receptors. For a smaller subset of these genes, we show that NA release triggered by LC stimulation is sufficient to mimic the stress-induced transcriptional response. We observe these effects in both sexes, independent of the pattern and frequency of LC activation. Using a retrograde optogenetic approach, we demonstrate that hippocampus-projecting LC neurons directly regulate hippocampal gene expression. Overall, a highly selective set of astrocyte-enriched genes emerges as key targets of LC-NA activation, most prominently several subunits of protein phosphatase 1 (Ppp1r3c, Ppp1r3d, Ppp1r3g) and type II iodothyronine deiodinase (Dio2). These results highlight the importance of astrocytic energy metabolism and thyroid hormone signaling in LC mediated hippocampal function, and offer new molecular targets for understanding LC function in health and disease. Copy rights belong to original authors. Visit the link for more info Podcast created by Paper Player, LLC
Link to bioRxiv paper: http://biorxiv.org/cgi/content/short/2023.01.25.525492v1?rss=1 Authors: Fontana, B. D., Reichmann, F., Tilley, C. A., Lavlou, P., Shkumatava, A., Alnassar, N., Hillman, C., Karlsson, K. A., Norton, W. H. J., Parker, M. O. Abstract: Externalising disorders (ED) are a cause of concern for public health, and their high heritability make genetic risk factors a priority for research. Adhesion G Protein-Coupled Receptor L3 (ADGRL3) is strongly linked to several EDs, and loss-of-function models have shown impacts of this gene on several core ED-related behaviors. For example, adgrl3.1-/- zebrafish show high levels of hyperactivity. However, our understanding of the mechanisms by which this gene influences behavior is incomplete. Here we characterized, for the first time, externalizing behavioral phenotypes of adgrl3.1-/- zebrafish and found them to be highly impulsive, show boldness in a novel environment, have attentional deficits, and show high levels of hyperactivity. All of these phenotypes were rescued by atomoxetine, demonstrating noradrenergic mediation of the externalizing effects of adgrl3.1. Transcriptomic analyses of the brains of adgrl3.1-/- vs wild type fish revealed several differentially expressed genes and enriched gene clusters that were independent of noradrenergic manipulation. This suggests new putative functional pathways underlying ED-related behaviors, and potential targets for the treatment of ED. Copy rights belong to original authors. Visit the link for more info Podcast created by Paper Player, LLC
Link to bioRxiv paper: http://biorxiv.org/cgi/content/short/2022.11.22.517460v1?rss=1 Authors: Sulkes Cuevas, J. N., Watanabe, M., Uematsu, A., Johansen, J. P. Abstract: The locus coeruleus (LC) is a small region in the pons and the main source of noradrenaline (NA) to the forebrain. While traditional models suggested that all LC-NA neurons project indiscriminately throughout the brain, accumulating evidence indicates that these cells can be heterogeneous based on their anatomical connectivity and behavioral functionality and exhibit distinct coding modes. How LC-NA neuronal subpopulations are endowed with unique functional properties is unclear. Here, we used a viral-genetic approach for mapping anatomical connectivity at different levels of organization based on inputs and outputs of defined cell classes. Specifically, we studied the whole-brain afferent inputs onto two functionally distinct LC-NA neuronal subpopulations which project to amygdala or medial prefrontal cortex (mPFC). We found that the global input distribution is similar for both LC-NA neuronal subpopulations. However, finer analysis demonstrated important differences in inputs from specific brain regions. Moreover, sex related differences were apparent, but only in inputs to amygdala-projecting LC-NA neurons. These findings reveal a cell type and sex specific afferent input organization which could allow for context dependent and target specific control of NA outflow to forebrain structures involved in emotional control and decision making. Copy rights belong to original authors. Visit the link for more info Podcast created by Paper Player, LLC
In this episode of Brain Health Matters, Amen Certified Brain Health Professional Kate Kunkel shares some of the latest important research on risk factors for dementia and other brain disorders including dementia and anxiety.Knowledge is power, and Kate has given you several powerful steps based on this research to help you protect your health and lower your chances of developing cognitive decline.You can follow up on this research with the links provided here:Sleep and Noradrenaline https://www.sciencedaily.com/releases/2022/07/220714103016.htm Antibiotics and depression and anxiety: Neuroscience News https://neurosciencenews.com/antibiotics-negative-emotion-20988/Optimism for a healthier brain: https://www.awakeningfromalzheimers.com/studies-prove-optimists-are-less-likely-to-get-dementia/Chronic disease and dementia risk: https://www.bmj.com/content/376/bmj-2021-068005Obesity and dementia risk: https://www.marketwatch.com/story/this-is-now-the-no-1-preventable-cause-of-alzheimers-in-america-11657553007Surgery and brain health risks: https://www.amenclinics.com/blog/anesthesia-and-the-risk-for-postoperative-cognitive-dysfunctionLearn many more ways that improve and protect your brain in Kate's book, Don't Let the Memories Fade, available in paperback and as an eBook on Amazon everywhere. To begin your journey toward a healthier brain, claim your free copy of Kate's Five Key Steps You Can Take Right Now to Improve Your Brain
A recent study confirmed that Americans are exercising less and sitting more during the pandemic. It may seem like no big deal, but the pandemic has impacted everyone's mental health as well. So, it's important to recognize the important and positive link between mental health and exercise. Studies have shown that exercise can be a great tool for improving common mental health issues. Episode HighlightsExercise enhances concentration, mood, energy and motivation with neurochemical changes that increase:- BDNF (Brain-derived Neurotrophic Factor)-the brain's own “Miracle Gro”- Dopamine-which helps motivate you- Serotonin-which boosts your mood- Noradrenaline-which stimulates your energy- New connections between nerve cells and neuronsExercise:- Boosts memory- Increases concentration- Improves mental health- Enhances creativity- Slows cognitive decline- Improves circulation- Aids learning and memory- Builds more brain cells- Prevents diseaseOriginal podcast theme music by Lance Keltner. https://www.youtube.com/user/lancekeltner This episode of the #FeelingsMatter Podcast was recorded at MSR Studios in Saint Paul, MN and produced by Kel Skonberg of Mossy Stone Media. Copyright 2022, all rights reserved. No reproduction, excerpting, or other use without written permission.This episode is sponsored byMindful Appy, the only software suite for the Net Emotional Indexhttps://mindfulappy.com/Don't miss a moment of the conversation, subscribe to the show on your favorite podcasting platform and sign-up for the #FeelingsMatter mindfulness tracking project - Text the emoji that best represents the way you feel to (972) 778-6835
In this episode, we discuss the evidence behind the choice of adrenaline vs noradrenaline in patients who achieved ROSC (return of spontaneous circulation) after OHCA(out of hospital cardiac arrest).
In this episode, we are talking about vasopressors and inotropes in Anaesthesia. The information and detail provided here are for residents and junior registrars starting in their first few months of Anaesthesia. There is a lot more detail to know for the Primary Exam, but this will give you a good starting point to perform at your best when starting out.A lot of useful information can be gathered from this textbook:Pharmacology for Anaesthesia and Intensive Care 5th Editionhttps://amzn.to/3u3xqS1https://amzn.to/3ACOwbIAll opinions expressed here are our own, and based on our experiences, and are not reflective of our employers or our associated training programs.Please refer to ANZCA, hospital and training network-specific documents and information for the most up to date information and guidance on the application process.If you have any questions, please email anaesthesiapodcast@gmail.com-------------------------------------------------------------------------------------------------------Please rate, post a review and subscribe!Check out https://anaesthesiacollective.com/ for more useful informationandsign up to the ABCs of Anaesthesia facebook group https://www.facebook.com/groups/2082807131964430and check out the ABCs of Anaesthesia YouTube channel for more contenthttps://www.youtube.com/c/ABCsofAnaesthesiaDisclaimer:The information contained in this podcast is for medical practitioner education only. It is not and will not be relevant for the general public.This contains general information about medical conditions and treatments. The information is not advice and should not be treated as such.The medical information is provided “as is” without any representations or warranties, express or implied.The presenter makes no representations or warranties in relation to the medical information on this episode.You must not rely on the information as an alternative to assessing and managing your patient with your treating team and consultant.You should seek your own advice from your medical practitioner in relation to any of the topics discussed in this episode'Medical information can change rapidly, and the author/s make all reasonable attempts to provide accurate information at the time of filming. There is no guarantee that the information will be accurate at the time of viewingThe information provided is within the scope of a specialist anaesthetist (FANZCA) working in Australia.The information presented here does not represent the views of any hospital or ANZCA.These podcasts are solely for the training and education of medical practitioners and are not an advertisement. They were not sponsored and offer no discounts, gifts or other inducements.This disclaimer was created based on a Contractology template available at http://www.contractology.com.
Straight from a Scientist Medical Research Education and Discussion Podcast
This episode is about neural networks on noradrenaline- the key neuromodulator known to flip almost every switch in the brain! Drs. Esteban Oryarzabal and Connor Wander break down how noradrenaline, or norepinephrine help regulate brain states useful for attention and task-switching. The studies here cover a whole new way to interpret brain imaging studies, which could have huge implications for neuroscience everywhere! Youtube link: https://youtu.be/NyMQhw5NpG4 Please note that this episode is special- it's a preview from research that hasn't fully undergone peer review. This means that the findings discussed are still highly preliminary, and could be subject to change. That being said, it's an incredible body of work, and fascinating at a minimum! Source Paper: "Chemogenetic Stimulation of Tonic Locus Coeruleus Activity Strengthens the Default Mode Network" https://www.biorxiv.org/content/10.1101/2021.10.28.463794v2 From 2022 Brings new season for Straight from a Scientist Podcast. Connor has graduated from UNC Chapel Hill and is now embarking on a scientific industry career, where he explores the biology of aging. If you missed it over 2020 and 2021, check back for our Science Web Games-- Including two neuroscience games and a Coronavirus explainer: https://www.straightfromascientist.com/science-games/
How do we get creative again at the start of a new year? What tools are there out there to fire those creative juices back up? Are there specific creative chemicals present or that we can actively work on to get that magic back? The good news is, that Yes! There are, and that yes we can work on them. Noradrenaline is a chemical that is associated with being in our fight or flight mode and reducing stress creates more of this. Dopamine plays an extremely important role in the creative process. It is the chemical that allows our brain to wonder and think-up new ideas. Phenethylamine (PEA) is supposedly a chemical that coordinates all of the above brain chemistry. It is released when we are relaxing, having fun and feeling good about ourselves.... and lastly but by no means least? Serotonin is also worth a mention as it evidently plays a vital role in controlling our mood, which also leads to more creative spurts! Today's guest Susie Pearl is an author of a book called The Art of Creativity and talks to me not just about chemistry but how we can organically and quite easily and quickly turn our thoughts and mind towards becoming more creative. She has spoken to many fellow creatives on her very own podcast, Conversations with Susie Pearl and we got deep into subject of her book, so that maybe you can take a few leaves out of it to get back into creative mode in 2022. If making a podcast is on your list of creative projects this year? Pop onto the www.resetrebelproductions.com website to take our beginners guide to makig your own podcast series on the island 25-28th January in Santa Gertrudis, or join us in February online via Zoom, drop me a mail : JO@JOYOULE.CO.UK for details.
Before I dive into my 5 favorite tips for IF, I want to touch on a few of the beneficial hormonal adaptations that occur as a result of fasting...Regular fasting, in addition to lowering insulin levels, has also been shown to improve insulin sensitivity significantly. This is the missing link in the weight-loss puzzle. Most diets reduce highly insulin-secreting foods, but do not address the insulin resistance issue. Growth hormone secretion decreases steadily with age. One of the most potent stimuli to growth hormone secretion is fasting. Long term studies of intermittent fasting prove that the fasting strategy is more than 4 times better at preserving lean mass percentage compared to caloric restriction.Noradrenaline levels are increased so that we have plenty of energy to go get more food. For example, 48 hours of fasting produces a 3.6% increase in metabolic rate, not the dreaded metabolic ‘shut-down'. In response to a 4-day fast, resting energy expenditure increased up to 14%. Rather than slowing the metabolism, instead the body revs it up. Presumably, this is done so that we have energy to go out and find more food.So my 5 favorite tips to make your fast effective and easy...Eat Clean - Lack of hunger when eating low carb has been linked to ketosis, a metabolic state in which your body runs mainly on fat — at least some of which is body fat — and breakdown products of fat called ketones. Studies clearly show that these diets reduce hunger, though the mechanisms via which ketones reduce hunger are only partly understood. Said more simply, low-carb diets higher in protein, fat, and fiber-filled veggies increase “fullness” hormones, like CCK and PYY, and decrease “hunger” hormones, like ghrelin. Eating whole foods is a good rule of thumb. Low carb (veggies and moderate fruit) - High Protein (grass fed, grass finished nose to tail) - Moderate Fat (cook in tallow, grass-fed butter)Stay Busy - Trick the mind. Find things to do like work, read or perhaps go for a walk. The busier the day the easier it is to fast and stay out of the kitchen.Start Slow - Push back breakfast an hour every few days. Go at your own pace.Stay Hydrated - Eating less often provides less water. If you make the switch to a low-carb diet, you are probably eliminating processed foods from your diet, which contain high amounts of sodium. Second, low-carb diets are diuretic in nature, meaning the kidneys excrete electrolytes at a higher rate. This is normal and not something to be worried about, but it is important to replace these electrolytes. By properly supplementing your electrolytes, adding salt to water, and/or drinking mineral water commonly contains substances like magnesium, calcium, sodium, and zinc, and, according to recent research, they're actually a pretty effective way to boost your mineral intake. At its core, mineral water provides minerals the human body can't create itself.Ride out hunger waves - Ghrelin is the so-called hunger hormone. So, if you want to lose weight on a long-term basis, you need to tune down ghrelin. Hunger can be a learned response. We are used to eating three meals per day, so we begin to get hungry just because it is ‘time to eat'. But if you don't eat at those times, ghrelin DOES NOT CONTINUALLY INCREASE. After the initial wave of hunger, it recedes, even if you don't eat. Hunger comes as a wave. After it passes, it loses much of its power. Ghrelin spontaneously decreases after approximately two hours without food consumption. If you simply ignore hunger and don't eat, it will disappear. The average ghrelin levels over 24 hours of fasting decreases! In other words, eating nothing makes you less hungry.There you have it, my favorite tips to make fasting a breeze! -Always be sure to consult with a physician before you start fasting.-Have a great day!If you love the Get Lean Eat Clean Podcast, we'd love for you to subscribe, rate, and give a review on iTunes. Until next time!Links:Watch Get Lean Eat Clean podcast video episodes on YouTube!https://www.21dayfastingchallenge.com/X3 Bar: Variable Resistance Technology allows for a full body workout in only 10 minutes! Use discount code "Save50" for $50 off your purchase! | https://www.anrdoezrs.net/click-100286468-13650338Interested in becoming a Keto Coach - Here's a certification for you!https://kate-jaramillo.mykajabi.com/a/13557/nwzmzvre| Listen to the Get Lean Eat Clean Podcast |►iTunes | https://podcasts.apple.com/us/podcast/get-lean-eat-clean/id1540391210►Spotify | https://open.spotify.com/show/0QmJzYZsdV6tUNbDxaPJjS| Connect with Brian |►Website | https://www.briangryn.com►Instagram | https://www.instagram.com/bdgryn►Facebook | https://www.facebook.com/getleanandeatclean►Twitter | https://twitter.com/grynnerwinner
Let's talk about benzodiazepines. What are benzodiazepines, what are benzodiazepines used for, and is there a natural alternative? Yes, there is! Benzodiazepines are used for conditions, such as: • Anxiety • Panic attacks • Insomnia • Epilepsy Benzodiazepines manipulate neurotransmitters, including serotonin, GABA, and noradrenaline. Serotonin is known to help bring up your mood, improve anxiety, and even decrease cravings. Noradrenaline is known to help focus your attention, improve vigilance, decrease depression, increase blood pressure, and mobilize the brain and body. It's lowest when you're asleep and highest when you're in fight or flight mode. Magnolia bark is a natural remedy that has been found to potentially work just as well as benzodiazepines for some people. Magnolia bark has special properties that actually mimic benzodiazepines. Potential benefits of magnolia bark: • It's anti-anxiety (decreases cortisol) • It may help improve sleep (increases GABA) • It may help inhibit epileptic seizures • It supports menopause • It may help relieve depression (increases serotonin and noradrenaline) • It may help decrease a fatty liver • It has properties of cancer inhibition If you're on a benzodiazepine, definitely check with your doctor before coming off of it. But, ask your doctor about magnolia bark to see if this more natural solution that doesn't have a lot of side effects could work for you. Dr. Eric Berg DC Bio: Dr. Berg, 51 years of age is a chiropractor who specializes in weight loss through nutritional & natural methods. His private practice is located in Alexandria, Virginia. His clients include senior officials in the U.S. government & the Justice Department, ambassadors, medical doctors, high-level executives of prominent corporations, scientists, engineers, professors, and other clients from all walks of life. He is the author of The 7 Principles of Fat Burning. Dr. Berg's Website: http://bit.ly/37AV0fk Dr. Berg's Recipe Ideas: http://bit.ly/37FF6QR Dr. Berg's Reviews: http://bit.ly/3hkIvbb Dr. Berg's Shop: http://bit.ly/3mJcLxg Dr. Berg's Bio: http://bit.ly/3as2cfE Dr. Berg's Health Coach Training: http://bit.ly/3as2p2q Facebook: https://www.facebook.com/drericberg Messenger: https://www.messenger.com/t/drericberg Instagram: https://www.instagram.com/drericberg/ YouTube: http://bit.ly/37DXt8C
In this episode, we discuss the modified Pomodoro technique to help Primary candidates prepare for their exams during daily bedside ward rounds. 3 questions were discussed in this episode - Pulse oximeter, Comparison between Noradrenaline and vasopressin, and physiological effects of hypoxia.
I got to sit down again with one of the worlds leading strength and performance coaches, and fellow Dad Bod- Christian Thibaudeau We talked about an amazing array of topics , focusing on optimising human performance, human brain performance both for general health as well as sporting excellence. Christian is a neurotyping and neuromuscular efficiency expert. You can find out more about his programs and work with him at www.thibarmy.com Topic we covered of note were: Explaining all about CORTISOL- The Readiness Hormone Fast /slow adrenaline clearance in different people (COMT enzyme) Noradrenaline speeds up neurons Glutamate acts as an emotion amplifier, causing emotive memories to be stored long term, How exercise variation in itself can be an added stressor- to be used wisely Psychology can be a manifestation of Biology Strength is a SKILL How to choose the best program for your neurotype How ketones convert glutamate to GABA- resulting in a 39% reduction in Anxiety Using 10 grams of tyrosine before specific workouts Cellulite tips and Solutions
Julien Pineau and Ricahrd Aceves from StrongFit join the show to discuss nervous system regulation, the role of noradrenaline and lactate in the mind and the body, and movement as a tool for improving mental health.Who is Julien Pineau? Julien Pineau is a Humanist, Movement Specialist, and Founder of StrongFit, an intellectual and physical gym that has transcended the actual workout into an education. It’s a culture and a tribe of people who seek to apply force better. Julien is trained to visualize and correct proper human movement patterns. He has a fascinating ability to diagnose imbalances, find the root of problems, and provide knowledge so you can become stronger, more fit, and a more resilient human. When he is not busy traveling, podcasting or changing the world he is raising his daughter in an environment of love and curiosity. He is a man on a journey inward as much as he is outward. Who is Richard Aceves?Richard Aceves has a diverse athletic background that started with powerlifting, which provided him with a solid strength foundation. Richard started Crossfit in 2007 and was immediately addicted to the push that the sport provided.Richard has worked tirelessly in understanding the human body and its mechanics, as well as, working towards becoming an elite powerlifter, professional GRID athlete, and attempting to get his pro card for Strongman. He is adept at identifying the missing link and targeting it, so that athletes can perform better and with less chance of injury. He is adamant that his athletes build a solid foundation and have a clear understanding of the mechanics required to exercise correctly. His number one priority as a coach is making sure his athletes are healthy and safe.Highlights[2:38] Karl J. Friston and the free energy principle[11:40] Burn The Questions[18:15] Lactate as fuel for the brain and the body[32:03] Baseline vs. Stress Response: the Role of Noradrenaline[1:01:30] Movement: the lactate connection to the brain[1:07:17] Emotional mapping[1:10:40] Using training as a tool to manage stress response[1:25:31] The future of StrongFitResourcesKarl J. FristonBurn The QuestionsTom PlatzAvicii: True StoriesWhat is Life? By Erwin SchrodingerEgo Is the Enemy by Ryan HolidaySponsorsBiOptimizersAccording to the American Psychological Association, “chronic stress is linked to the six leading causes of death. ”Stress has been implicated in heart issues, inflammation, obesity, mental illness and more.Most people think of stress as caused by things like work, traffic, tense relationships…And they focus on “solutions” like meditation, going to the spa, and so on.But what if the ROOT of so much stress we experience…comes down to deficiency of this one overlooked nutrient? That nutrient is Magnesium.Magnesium is the body’s “master mineral” powerful over 300 critical reactions, including detoxification... fat metabolism... energy... stress...EVEN digestion is influenced by the presence of magnesium. If there’s ONE MINERAL you should be worried about not getting enough of... it’s MAGNESIUM. That’s why I’m so excited to tell you about a new magnesium product called, Magnesium Breakthrough. It’s the ULTIMATE magnesium supplement, easily the best I’ve ever seen or experienced... with all 7 forms of this mineral.I was able to arrange for some stock to be set aside just for our audience and it's be best deal available on this product.Seriously! With volume discounts combined with our custom 10% coupon code, boomer, you can save up to 40% off select packages of Magnesium Breakthrough! That’s an AMAZING value. That deal is ONLY available on this specific website, bioptimizers.com/boomer.You won’t find that deal on Amazon or even the company’s own website.Magnesium Breakthrough is the most effective magnesium supplement I’ve ever tried. Say goodbye to having to buy 7 different bottles of magnesium to get the complete dose (which is an excellent way to fill up a carry on bag).Go to bioptimizers.com/boomer and use coupon code boomer to save up to 40% off select packages to get the most full spectrum and effective magnesium product ever.Continue Your High Performance Journey with StrongFitWebsiteFacebookYouTubeInstagramPodcastDisclaimer This information is being provided to you for educational and informational purposes only. This is being provided as a self-help tool to help you understand your genetics, biodata and other information to enhance your performance. It is not medical or psychological advice. Virtuosity LLC, or Decoding Superhuman, is not a doctor. Virtuosity LLC is not treating, preventing, healing, or diagnosing disease. This information is to be used at your own risk based on your own judgment. For the full Disclaimer, please go to (Decodingsuperhuman.com/disclaimer). See acast.com/privacy for privacy and opt-out information.
This week, we look at the role noradrenaline may play in symptoms of Anxiety, Depression, and Schizophrenia.. *Join the StrongFit Channel and get early episode access, premium assessment videos, and tons of premium content. https://www.youtube.com/channel/UCfVYWRf1wZZg1mktAgGY9og/join *Support the podcast at https://podcast.strongfit.com 6 WEEK STRONGFIT COACHES COURSE - https://learning.strongfit.com/offers/ao5kRyqn Join Tyler’s Meathead Muscle Big Rig Training Block at learning.strongfit.com/letsgetthick Check out THE STRONGFIT LIBRARY at https://strongfitlibrary.com/ Get in on the the Functional Integration Training Template by clicking HERE: https://learning.strongfit.com/FITT?fbclid=IwAR3F9eqO5r-rtHnh6DQvTZTIrr0ec1kMxkgFfKDRlsAgRE9k3O1226tn8xA Want to get 1:1 coaching from Julien? Limited spots available, CLICK HERE: https://learning.strongfit.com/one-on-one?fbclid=IwAR1JGA3NnINQMhZ_5Ae9oATJ8YZ2NytOOxjM9nJKCcAYGmk-kpZ_o6V--RY Got questions you'd like Julien to answer on The StrongFit Podcast? Go to https://docs.google.com/forms/d/1vtLrt05UrtAeBs5w6VT-1F6NexYyi7WHpKh6x8V0NFs/viewform?fbclid=IwAR0XX9XrNQ2eUKIvXkSEby-6-fP6t6qhTwwfT1m27hpoga-73dqqMn9jNsk&edit_requested=true Catch a seminar or event near you at https://strongfit.com/seminars Google Play Music - https://play.google.com/music/m/I25v2dbaxgy4b7wyrj4xkreh27a?t=StrongFit_Podcast_-_Tete_A_Tete Spotify - https://open.spotify.com/show/6ucwCFZmRFYEM0SvNiDTV8 Apple - https://podcasts.apple.com/us/podcast/strongfit-podcast-t%C3%AAte-%C3%A0-t%C3%AAte/id1440599095 Stitcher - https://www.stitcher.com/podcast/strongfit-podcast-tete-a-tete — Website: http://strongfit.com Sandbags: https://strongfitequipment.com/ — Instagram: http://instagram.com/strongfit1 Equipment: http://instagram.com/strongfitequipment Contact: info@strongfit.com — Edit by Tyler Stone @tylereffinstone
In the age of stress, overwhelm, and distraction - it's time to take control and go deeper.We’re surrounded by stressors that steal our time, energy, youth, wealth, and health. Everything from endocrine disruptors to hidden chemicals, EMF’s to negative thought patterns impact us to a tremendous degree. These stressors eventually add up and accelerate aging, cognitive decline and increase risk of disease It’s no wonder only 2% of surveyed women feel great about their health and beauty. But that’s just life, right? And the signs of aging, awful hot flashes in menopause and weight gain are normal, right? Maybe - NOT.Every system in your body is affected by hormones. Our hormonal matrix is extremely complex, which is why having a complete picture of just what is going on with them is key to understanding our health and how well we are aging. What it all comes down to is giving yourself the right information and knowledge to understand your complete hormonal picture so that you can best take charge of your wellbeingIt’s an absolute honor to have Dr. Carrie Jones join us so we can shine a very bright light on understanding how both internal and external stressors affect every transition of our hormonal pathway - which then affects our mood, vital hair growth, clear skin, sleep, mood and much more.We’ll also address how to TEST and NOT guess with the most comprehensive hormone test on the market today. About Dr. Carrie JonesDr. Carrie Jones is an internationally recognized speaker, consultant, and educator on the topic of women’s health and hormones. Her education is vast ranging from the National University of Natural Medicine to the School of Naturopathic Medicine in Portland, Oregon where she also completed her 2-year residency in women’s health, hormones and endocrinology.Dr. Carrie Jones is now the medical director of Precision Analytical, the creator of the DUTCH Test. Dr. Carrie is a driving force in the movement to understand complicated health issues of all sorts and their relation to hormones. On Today’s Episode You’ll Awaken to:The DUTCH test, it's an acronym: Dried Urine Test for Comprehensive Hormones.Blood Test and Saliva are the most common tests, but they dont give the complete picture.The urine test can pick up all the pathways to learn where hormones are going. How Stress hormones affect aging - meaning how can we support our hormones at every age so we feel great and age well. Hormones imbalance occurs at any age and it is important to look at the big picture - sooner than later.How we make, metabolize, mobilize and excrete hormones. How a lack of estrogen/hormones actually AGES us - and the impact of xenoestrogens. Do you take DIM? IC3? What supplements are best? Test - don’t guess, and then be patient and retest: 3-month full hormonal turnover pattern. Phases of Detoxification and the pathways. What water do we have - how fast is it coming in and is your drain open or closed? Hidden forms of inflammation and cortisol response from hidden viruses, mold, chemicals, water contaminants, radioactivity, etc. How do you hop into the CAR (Cortisol Awakening Response) in the morning? Constant Stress and Noradrenaline keeps us from repair, maintaining and reproducing healthy hormones. The importance of opening up the “drain” and working backwards so the metabolism of estrogen and other hormones are fully cleared. The key pathways consist of the 2/4/16 hydroxy pathway and are only visible the DutchHair Loss Epidemic - Hormones impacting and how to reverse. How we can reset our entire hormonal and endocrine health through resetting our circadian rhythms.Hormone replacement and how estrogen may actually save women and their health (skin, hair, bone health, emotional health and more).Implementation through testing is the KEY - and that is when we get a transformation. Put the lifestyle to work! “Having this information is very empowering because you can do something about it. You can do dietary, lifestyle, exercise, supplemental changes to redirect all these pathways.”What a women’s conventional experience is walking into their OBGYN when testing hormones - compared to what a woman recieves via the Dutch test. Resources:Dr. Carrie Jones' Website and Socials:http://www.drcarriejones.com/Instagram @dr.carriejonesFacebook: https://www.facebook.com/drcarriejones/ Share the Love:If you like The Awakened Beauty Podcast…Subscribe, Rate & Review via iTunesVisit us at awakenedbeautyhq.com for updates.Businesses: www.evoqbeauty.com | www.beautyecology.comInstagram @awakenbeautyhqInstagram @evoqbeautyWatch on YouTube at my channel: Awaken Beauty PodcastShop natural health and beauty products with EVOQHere’s how!Go to AwakenBeauty-hq on ITunes and write your biggest takeaway in the rate and review section. Just pretend it says “ah ha” here!! Don’t just review the episode, I would love your ah-ha moment from this episode that is more specific so you can confirm your takeaway as you write, but also help others capture your brilliance. It’ll take 3 minutes from your day. What you declare will be life to others. So remember, go to I tunes to rate and review.Comment or question you’d like to ask Kassandra.P.S!Your review is not only paramount in helping others discover the show, but we also read each and every submission personally… and they mean the world to us.Love and Light! - KassandraIn the Meantime, STAY IN THE CONVERSATION! @awakenbeautyhq | #awakenbeautyLeave a comment below - let us know what you think!
Marie Antoinette's hair suddenly turned white before the ill-fated French queen was taken to the guillotine to have her head chopped off, according to some historical accounts.More modern reports refer to hair turning prematurely white in survivors of bomb attacks during World War II, while an Australian airline pilot saw his hair go grey in the months after landing a plane following a failure of all four engines in the early 1980s.While there's been plenty of anecdotal evidence suggesting premature greying can be caused by extreme stress -- whether this is true and how this happens isn't widely understood.Now, Harvard University scientists think they have the answer -- at least in mice.The group of researchers believe it's down to the animal's sympathetic nervous system -- which is best known for activating our "fight or flight" response to danger, they say."Under stress, our sympathetic nerve becomes highly activated," said Ya-Chieh Hsu, associate professor of stem cell and regenerative biology at Harvard, in an email. "And actually, activation of the sympathetic nervous system under stress is supposed to be a good thing."Its activation triggers the "fight or flight" response through the neurotransmitter norepinephrine, or noradrenaline, explained Hsu, a senior author of the study published Wednesday in the scientific journal Nature. "Noradrenaline raises our heartbeat and allows us to react quickly to danger without having to think about it," he said."However, it is the same noradrenaline that turns out to be bad for melanocyte stem cells at a high level, and triggers their loss."Melanocyte stem cells are found in hair follicles and determine hair colour. In people, the pool of these cells deplete as they age, turning hair grey as pigment depletes. Their loss from excessive noradrenaline could be causing this to happen prematurely, the team suggest.Loss of pigmentThe team had thought that acute stress might trigger an immune attack on pigment-producing stem cells or that the blame lied with the hormone cortisol because cortisol levels are elevated under stress. Hsu said they went through many different possibilities before focusing on the sympathetic nervous system."We were really surprised to find that it was the culprit, because it is normally seen as a beneficial system, or at least transient and reversible," she said.The team put mice under three different types of stress through what Hsu described as established standard protocols. These included a single injection of a chemical to activate the mouse's pain fiber, cage tilting and rapid changes between light and dark.Changes were observed in all mice but there was some variability, with white hair only coming out after all the stem cells are gone."Some hair follicles have reduced levels of melanocyte stem cells so they can still make pigment, while others have lost all stem cells and can't make pigment anymore, so the hair becomes white," she said.Pigment-producing stem cells and the sympathetic nervous system are very similar in mice and humans, explained Hsu who was hopeful that the mechanisms would be related. But future studies would be needed to provide definitive evidence, she said."Everyone has an anecdote to share about how stress affects their body, particularly in their skin and hair — the only tissues we can see from the outside," Hsu said in a news release."We wanted to understand if this connection is true, and if so, how stress leads to changes in diverse tissues. Hair pigmentation is such an accessible and tractable system to start with — and besides, we were genuinely curious to see if stress indeed leads to hair greying."Hsu said the findings may also help shed light on the effects of stress on various organs and tissues, and pave the way for new studies that seek to modify or block the damaging effects of stress.In an accompanying article, Shayla Clark and Christopher Deppmann, researchers from the Neuroscience Graduate Prog...
Welcome to the “Neuroscience Meets SEL” podcast EPISODE #29, my name is Andrea Samadi, a former educator who has been fascinated with understanding the science behind high performance strategies in schools, sports and the workplace for the past 20 years. Let’s dive right into this topic on “How to Re-Wire Your Brain for Happiness and Well-Being to Optimize Learning.” You can watch this episode on YouTube for the visual effects for more impact and learning. I’m sure most of us are aware that stress is the number one cause behind anxiety, depression, low energy, work burn-out, and cardiovascular disease[i], but do you know how stress impacts our brain? Did you know that:Chronic stress and depression causes measurable brain shrinkage?[ii]“51% of us will have a mental health issue (post-traumatic stress, obsessive-compulsive, personality, anxiety, addiction, or an eating disorder to name a few) at some point in their life”[iii] andthat 1/5 students struggle with depression, while ¼ struggle with anxiety which means we have reached epidemic levels with today’s youth.And these shocking statistics impacts society with:Work burn-outAnxiety and DepressionCardiovascular DiseaseNeurological Disorders and eventually leading toDeathAlso Impacting our Students:A recent study[iv] shows that if the educator is stressed, the student will also be stressedStress is impacting our ability to learnStudent behavior was also impacted, contributing to more stress for educatorsDr. Daniel Amen, a psychiatrist and brain disorder specialist of the Amen Clinics[v] and the father of Chloe Amen from podcast #25 with “Strategies to Change Your Brain to Change Your Grades”[vi] explains that “if you struggle with attention, focus, sadness, anxiety, worry, flexibility, stubbornness, or impulsivity, welcome to the club—this is normal.”[vii] These days it is more normal to have a problem, than not have a problem. Most of us will have a mental health issue in our lifetime—and when it happens, we think that we are the only one and that no one else understands. Dr. Amen has a book coming out in March 3, 2020 called “The End of Mental Illness: How Neuroscience is Transforming Psychiatry and Helping Prevent or Reverse Mood and Anxiety Disorders, ADHD, Addictions, PTSD, Psychosis, Personality Disorders and More.”[viii] If left untreated, these brain disorders can have “serious personal, interpersonal, occupational and social consequences.”[ix] In this podcast episode, we are going to look at the neuroscience of happiness, anxiety, stress, learning and retention with some ideas and strategies to naturally improve each area, so that we can get a handle on life’s largest challenges with an understanding of our brain chemistry. Our goal is to intentionally set ourselves up for success with this new level of awareness.We will cover:A reminder of the recipe for peak performance (fun, fear, focus) from episode #27.What’s the neuroscience of happiness—and how to boost our serotonin levels to generate more happiness.What’s the neuroscience of anxiety (our body’s natural response to stress that can become a mental disorder when someone regularly feels unusually high levels of anxiety) and stress (which is our body’s response to a challenge or demand) with strategies to calm our limbic, emotional brain.What’s the neuroscience of learning and how can we be sure that our brain is primed to learn?All of the answers to these questions can be found within the chemistry of our brain and with how active or hard certain parts of the brain are working. The best course I have taken to understand how my own brain is working is Dr. Amen’s Thrive by 25 Online Course[x] where he outlines some of the most common problems he sees within the brain with natural solutions to overcome each challenge. The most interesting fact I found was that diet and exercise were solutions to the most common brain problems he spoke about, (anxiety/depression/emotional issues) so if you are eating healthy, getting enough sleep, taking supplements and exercising, you are on the right track for preventing the most common brain problems. Have you ever thought about your brain with regards to your work, learning, success or productivity? What about your happiness, personal life or relationships? “Your brain controls everything that you do, so when it works right, you work right.”[xi] It’s only been the past five years for me, where I’ve been learning about the importance of my brain and its health and I’m not surprised that the recent advances in neuroscience have led to an emerging field of educational neuroscience—bringing together researchers in cognitive neuroscience, educational psychology, and technology to create new programs for the classroom. Why not look at the application of these ideas for the workplace and our personal lives as well?Mental health is something that society still doesn’t talk openly about. When I look at my personal family situation, with my 2 parents and 2 sisters and myself—my parents and both of my sisters struggled with depression at one point. You can add me to statistics as I didn’t figure out healthy eating habits until my late 20s when a doctor[xii] recommended I cut sugar out of my diet, (I’m talking about all sugar, including high glycemic fruits) and it completely transformed my life, cleaning up every health issue I had. Although our family didn’t talk about the importance of our mental health growing up, or the importance of diet and exercise (I remember begging my Dad to let me go running in an ice storm because exercise has always been my solution to improve well-being) my Mom taught us about the importance of using our mind to attain our goals. I’m sure no one was surprised when I decided to take move from Toronto (where half the year we dealt with dark, gloomy days and freezing weather) to the sunny, bright and warm climate in Arizona, with year round sunshine and vast mountains for daily exercise, --what research shows combats the most common brain problems. The environment you live in impacts your happiness, but if you don’t have the ability to pick up and move somewhere else, there are many other strategies you can incorporate to boost your mood, which is turn will boost your results. As a kid, I also wondered if helping my parents more with tidying the house would help offset some of their stress, but I know now, that there was much more involved with what was happening to them than just needing help with housework. Understanding the chemistry of our brain, and what brain type[xiii] we have is important, and then we can look for strategies to help promote our brain and body health for optimal results in our life.NOTE: Look up and take Dr. Amen’s Brain Type Assessment[xiv] to get an idea of what type of brain you have. You will receive an email with a video explaining your brain type, characteristics of this type of brain, dietary suggestions for your specific brain type and a full report with your brain fit score. My Brain Fit Score was 82/100 and Brain Type 1 and I’m fully aware of the areas I can improve on. The dietary suggestions were also right on the mark for me. Awareness is the key so that we can take action for these improvements to occur. Try it out!Remember the Neuroscience of Success: Dopamine, Noradrenaline, Acetyl Choline (Fun, Fear, and Focus)In our podcast #27 with Friederike Fabritius, we covered the DNA of success or peak performance[xv] which is that brain state where we lose the presence of time and are the most productive. She mentioned the importance of having fun with your work, releasing the neurotransmitter dopamine, having just enough fear or a challenge to release the neurotransmitter noradrenaline and that with these two factors, focus will occur, and the neurotransmitter acetyl choline will be released. These three factors must be in place for peak performance to occur and when we hit this level of performance, it’s important that we are able to manage our distractions so that we can stay here for as long as possible for those higher levels of productivity.Throughout the episodes on this podcast, I’ve been focused on finding those leaders who are doing important work in the field of social emotional learning and neuroscience—to show how these two emerging fields can impact our cognitive abilities. It’s clear that people are drawn to this work, not just in schools, but this understanding has implications in different areas of society like economics, law and security.[xvi] It’s interesting to see how understanding how our minds and brains work in addition to self-awareness is spreading around the world as more and more people are looking for solutions to life’s challenges from within. I also noticed that listeners to this podcast are increasing rapidly as we now are in over 42 countries. I do appreciate the feedback and support for these ideas, and it does help me to hear what you think as we move ahead. Each of these episodes are currently being transcribed and will be released as my next book.What is the Neuroscience of Happiness? Increase Serotonin with that 5:1 Ratio of Positives to NegativesWe all want to experience happiness, and there is a neuroscience to happiness. Dr. Rick Hanson, a neuropsychologist and New York Times Best Selling author, is one of the leading experts in the neuroscience of happiness. In the 2019 Mindful Peace Summit, he opened his session by explaining that he got into the work of mindfulness and began searching for answers to the neuroscience of happiness because in his youth he “wondered why people were so unhappy, including himself. He wanted to be less lonely, and more proud of himself”[xvii] and recalled that most of his childhood consisted of feeling “less than” others so he grew up lacking confidence in himself. If we don’t get the acceptance we needed growing up, that will translate into an emptiness that lingers in your mindset and will impact our future performance. Dr. Hanson explains that if you want to be more confident, you must “embrace experiences that bring out your confidence.”[xviii] We see many young people, like the successful podcaster Lewis Howes,[xix] (Who does The School of Greatness Podcast)[xx] who were bullied as a kid, turn to boxing or wrestling as a way to fight back and gain this confidence back.Dr. Hanson noticed in college that when he ignored how he was feeling, he just kept feeling bad about himself, but when he had a positive experience, and stayed with it, over time he was able to build more positive experiences than negative, building up his confidence. He explains that “neurons that fire together, wire together” and he was actually rewiring his brain from being insecure and negative, to confident and positive. We also know that you can “name it to tame it”[xxi] and when you are able to express what you are feeling, these feelings and emotions become manageable. There is also the negativity bias to be aware of where the brain must have at least a ratio of 5:1 positive to negative interactions so that the negative interaction won’t cause an impact. As parents, teachers, coaches and co-workers we must remember that when giving someone feedback, we must have at least five positive things to say to every one negative thing since “good experiences bounce off the brain like Teflon and bad experiences stick to the brain, like Velcro.”[xxii] Be sure to consciously focus on the positive experiences so you won’t let that one negative experience stick around, or it will impact your mindset and future results.Remember: The brain has mood chemicals called neurotransmitters that are “chemical messengers sent into the synapse (of a neuron) by an electrical charge in the axon, released at the synaptic gap to communicate with dendrites of another neuron, impacted heavily by exercise, and nutrition. Levels of the different neurotransmitters have a profound effect on emotion, perception, memory, alertness, and energy.”[xxiii] If you are someone who enjoys intense exercise, you will notice the benefits of endorphins that are released in the brain and reduce our perception of pain. Researchers are still not sure what causes us to have chemical imbalances in the brain, when we don’t feel right, there are some things we can do to change the chemistry of our brain. STRATEGIES TO INCREASE HAPPINESS and NATURUALLY INCREASE YOUR SEROTININ LEVELSEmbrace experiences that bring out your confidence. Do you know what makes you happy? This takes self-awareness. Do you know what makes other people happy? Do you ask them? Learn more about other by saying “Hey, how’s it going today?” and listen to what they say. Taking this extra step will strengthen your relationship with your co-workers, friends or relationship.Remember the 5:1 negativity bias and say at least five positives to every one negative piece of feedback since good experiences bounce off the brain like Teflon and bad experiences stick to the brain like Velcro.Remember that “neurons that fire together wire together,”[xxiv] so stay with the positive feelings more and eventually the negative ones will fade away since neurons that are out of psych, fail to link.Think of news ways to “generate”[xxv] happiness and start practices that make you feel happier and better about yourself. It really is our responsibility to generate our own happiness. No one can do this for you.Diet and nutrition, supplements and exercise are also important to boost serotonin levels, increasing happiness naturally. You can take “saffron supplements, 5 HTP, exercise, eat low glycemic, healthy carbs (hummus/berries), and keep your gut healthy with probiotics.” [xxvi] The Neuroscience of Anxiety: Calming the Basal Ganglia Within our Limbic System, our emotional brain, is the Basal Ganglia that when revved high, makes us feel anxious. Do you know the difference between anxiety (our body’s natural response to stress that can become a mental disorder when someone regularly feels unusually high levels of anxiety) or stress (which is our body’s response to a challenge or demand)? Some anxiety is normal, and the same goes for stress.We know there are 3 levels of stress response.POSITIVE: Brief increase in heart rate, mild elevations in stress hormone levels (what happens when we need to speak in front of a crowd, play a sport, take a test, or that nervous energy we feel before a job interview).TOLERABLE: Serious, temporary stress responses, buffered by supportive relationships. The key is to have support systems in place for this type of stress.TOXIC: Prolonged activation of stress response systems in the absence of protective relationships. This is the one we are most concerned about as this type of stress causes the most damage.We must have strategies in place to help us to reduce anxiety and stress so that they don’t interfere with our day to day life.STRAEGIES TO REDUCE ANXIETY AND STRESSExercise, meditation and deep belly breathing to increase oxygen to the brain.Go for a walk outside-research shows that different brain regions are activated when you’re outside. Getting out into the sunshine increases the production of Vitamin D and serotonin—plus it just feels good. If you can’t go outside, look out a window.Zone out-let yourself do nothing for a while and just let your mind wander. Research shows that “creative incubation” happens during mind-wandering. You are more likely to problem-solve successfully if you let your mind wander and then come back to the challenge. Dr. Sriny Pillay writes about the power of the unfocused mind in his most recent book “Tinker, Dabble, Doodle, Try” where you sharpen your ability to think and get things done using your ability to make your mind wander. Flashes of insight and solutions to problems often show up at this time, but we must be willing to allow these breaks.Unplug from technology—silence is good for the brain.Mental imagery—warming images (like a cup of hot chocolate) if you are feeling stressed, or a place that makes you happy (the beach).Dietary supplements like fish oil, magnesium, l theanine (in green tea) and gabba supplements are known to help calm the brain.The Neuroscience of Learning: Acetyl Choline, Dopamine, Serotonin, NoradrenalineAs far as learning, think about this: Why is it that I can forget some words I used to know in French (but haven’t practiced in a few years) but that I will never forget my 6th grade teacher, Mr. Walker, teaching me to play basketball, or doing math equations.Why is it easier for me to learn a second language at age 5 versus age 55?Why do I learn better after a good night’s sleep?Why is my creativity enhanced when I run up and down a mountain before I sit at my desk?If there is a formula for peak performance, (Fun, Fear, Focus), a neuroscience to happiness and anxiety, then there must also be one for learning. Bruce McCandliss, professor in Stanford’s Graduate School of Education and the director of the Stanford Center for Mind, Brain and Computation, believes that brain-imaging technology is revolutionizing the study of educational experiences and their effect on the brain. These brain images are showing new insights in how children are learning to read. He talks about the fact that “when you focus your mind, you actually amplify the circuits in your brain that lead to learning and amplify information processing.”[xxvii] This is something we spoke to Dr. Daniel Siegel[xxviii] about (episode #28) with his “Wheel of Awareness” Meditation. When we are focusing intentionally on something (whether it’s our health, relationships, business or learning) we amplify the information processing and change the structure of the brain in this area. We actually re-wire the brain with the activity we are doing. Remember: Neurons that fire together, wire together and neurons that are out of psych, fail to link. Dr. Siegel mentioned that the research was there to show that this practice improves health in addition to many other benefits.Let’s see if we can take our understanding to the next level with how neuroscience impacts the learning process so we can create more impactful lessons as an educator, thoughtful skill-building drills as a coach, or connect our employees to new ideas and information in an engaging and enjoyable manner.STRATEGIES TO INCREASE LEARNING:USE EMOTION AND FREQUENCY OF USE: To help memories stick and “motivation, cues, context and frequency of use can all affect how accurately you remember something.” [xxix] It’s the reason I remember my 6th grade teacher, and frequency of use is the reason I have forgotten most of the French words I used to know. When learning a new skill, how will you make it memorable?FIND YOUR FOCUS: If you are a teacher who can creatively get your students to somehow “focus” on their work, you will be re-wiring their brain which will lead to learning. Whether it’s putting their finger under each word they read or using a pointer on their finger as they read, however you can get a student to focus on what they are learning, is where the magic happens. If you look at some of the most successful modern workplaces, you will find they have meditation and exercise rooms, dream walls to record vision and goals, plenty of relaxation areas, and of course, a place to grab a cup of tea, water or coffee. Think about starting meetings with a clear intention for the meeting to stay on track and focused on the outcome.MORE HAPPINESS, JOY, LAUGHTER: The brain thrives with happiness, joy and laughter. The more we can create fun with our learning, we have seen with peak performance and flow states, we will be encouraging learning in a way that time will be lost. Remember that the recipe for peak performance includes fun! Major Neurotransmitters that Impact Learning:Acetyl Choline - plays an important role in learning and memory.Dopamine - involved in conscious and emotional response and basis of the brain's natural reward system, associated with positivity.Serotonin – brain balancer, involved in arousal, temperature regulation, sensory perception, regulates melatonin, involved in relaxing, mood, emotions, learning and memory, affected by exercise, eggs, lean meat contains L-tryptophan which helps make serotonin.Norepinephrine/noradrenaline – arousal, involved in fight or flight stress response, metabolic rate, blood pressure, and mood.[xxx]On our next episode with Mark Waldman, we will uncover new brain research documented in Mark’s new book Neurowisdom[xxxi] showing that relaxation, creativity, imagination and intuition are essential for learning and problem solving.Discover how your brain likes to learn (it will surprise you and has nothing to do with what you’ve experienced the classroom) 2. Find out why mind-wandering and daydreaming are essential for psychological health. Right in line with Srinivasan Pillay’s book “Tinker, Dabble, Doodle, Try” that talks about the default network in the brain and the power of “unfocusing” your brain. Mark’s book “Neurowisdom” was the first book to talk about the default network mode and provides many practical examples for using your brain to improve finances, happiness and success. 3. Learn how Brain Network Theory is changing the world of neuroscience…and your health! 4. See what living neurons and networks actually look like.If we can intentionally practice strategies that reduce our stress and anxiety, while increasing our happiness, we will be well on our way to retaining what we are learning. See you next week!ADDITIONAL HELP SUGGESTIONS:These suggestions have been compiled as I am researching these areas to offers ideas, strategies and suggestions to bring more awareness to the topics. Please do know that the ideas and strategies I’m sharing with you should not replace seeking professional help[xxxii] if needed.[i] Chronic stress disrupts neural coherence between cortico-limbic structures João Filipe Oliveira, Nuno Sérgio Dias, Mariana Correia, Filipa Gama-Pereira, Vanessa Morais Sardinha, Ana Lima, Ana Filipa Oliveira, Luís Ricardo Jacinto, Daniela Silva Ferreira, Ana Maria Silva, Joana Santos Reis, João José Cerqueira, Nuno Sousa Front Neural Circuits. 2013; 7: 10. Published online 2013 Feb 6.[ii] 72 Amazing Brain Facts (Deane Alban, January 2018). https://bebrainfit.com/human-brain-facts/?fbclid=IwAR0amQTdwOEAlsh_7gQ34RhvJDZefHiZFVYGG7O__hGyOwD_j7lJM0qYxDA[iii] Brain Thrive by 25 Online Course by Dr. Daniel Amen https://www.amenclinics.com/blog/tag/brain-thrive-by-25/[iv] “Social and Emotional Learning, Teacher Well-Being, and Student Success: What Do We Know? And Where do We Go From Here?” Webinar June 5th 2018 with Dr. Mark Greenber, Penn State and Dr. Kimberly A. Schonert-Reichl https://vimeo.com/275147739[v] https://www.amenclinics.com/[vi] 15-year-old Chloe Amen Reveals Strategies on how to "Change Your Brain, Change Your Grades" https://podcasts.apple.com/us/podcast/15-year-old-chloe-amen-reveals-strategies-on-how-to/id1469683141?i=1000446233385[vii] ibid[viii]Dr. Daniel Amen, March 3, 2020 The End of Mental Illness: How Neuroscience is Transforming Psychiatry and Helping Prevent or Reverse Mood and Anxiety Disorders, ADHD, Addictions, PTSD, Psychosis, Personality Disorders and More. https://www.amazon.com/End-Mental-Illness-Neuroscience-Transforming-ebook/dp/B07T6C3CWH/ref=tmm_kin_swatch_0?_encoding=UTF8&qid=1574362380&sr=8-3[ix] https://www.amenclinics.com/spect-gallery/anxiety-depression/[x] Brain Thrive by 25 Online Course by Dr. Daniel Amen https://www.amenclinics.com/blog/tag/brain-thrive-by-25/[xi] Brain Thrive by 25 Online Course by Dr. Daniel Amen https://www.amenclinics.com/blog/tag/brain-thrive-by-25/[xii] Dr. Richard Jacoby and Raquel Baldelomar “Sugar Crush” (Harper Wave, 2nd Edition April 2015) https://www.amazon.com/dp/B00KPVB4OA/ref=dp-kindle-redirect?_encoding=UTF8&btkr=1[xiii] What’s Your Brain Type Quiz by Dr. Daniel Amen https://brainhealthassessment.com/[xiv] What’s Your Brain Type Quiz by Dr. Daniel Amen https://brainhealthassessment.com/[xv] Friederike Fabritius: "Fun, Fear, and Focus: The Neurochemical Recipe for Achieving Peak Performance" | Talks at Google Published Jan.15, 2019 https://www.youtube.com/watch?v=pWi-oCySuFA[xvi] Educational Neuroscience Michael Thomas Published July 5, 2018 https://www.youtube.com/watch?v=2uK3d9hL-IQ[xvii] 2019 Mindful Kids Peace Summit https://www.mindfulkidspeacesummit.com/first-page[xviii] Rick Hanson “Hardwiring Happiness” YouTube Published Nov. 7, 2013 TEDx Marin 2013 https://www.youtube.com/watch?v=jpuDyGgIeh0[xix] https://lewishowes.com/[xx]Lewis Howes School of Greatness Podcast https://podcasts.apple.com/us/podcast/the-school-of-greatness/id596047499[xxi] Dr. Dan Siegel “Name it to Tame it” YouTube Published Dec. 8th, 2014 https://www.youtube.com/watch?v=ZcDLzppD4Jc[xxii] Rick Hanson “Hardwiring Happiness” YouTube Published Nov. 7, 2013 TEDx Marin 2013 https://www.youtube.com/watch?v=jpuDyGgIeh0[xxiii] Neurotransmitters and Learning by Joseph Georgic April 22, 2015 https://www.hastac.org/blogs/joegeorgic/2015/04/22/neurotransmitters-and-learning[xxiv] “Neurons that Fire Together, Wire Together, So Simple” by Andrea Samadi on LinkedIn published Nov. 17, 2016 https://achieveit360.com/neurons-that-fire-together-wire-together/[xxv] Brendon Burchard “The Secret to Happiness” https://brendon.com/blog/the-secret-to-happiness/[xxvi] Brain Thrive by 25 Online Course by Dr. Daniel Amen https://www.amenclinics.com/blog/tag/brain-thrive-by-25/ (Lesson 4 Cingulate and Cognitive Flexibility).[xxvii] Bruce McCandliss “The Neuroscience of Learning: Thinking Big About Learning” YouTube Published Nov. 3, 2015 https://www.youtube.com/watch?v=5_6fezBz9IA[xxviii] Dr. Daniel Siegel on “Mindsight: The Basis for Social and Emotional Intelligence” https://podcasts.apple.com/us/podcast/clinical-professor-psychiatry-at-ucla-school-medicine/id1469683141?i=1000456048761[xxix] 72 Amazing Brain Facts by Deane Alban https://bebrainfit.com/human-brain-facts/[xxx] Lizzy Brown Learning on the Move: Brain Parts and Neurotransmitters https://www.learningonthemove.org/brain-parts--neurotransmitters.html[xxxi] Neurowisdom: The New Brain Science of Money, Happiness and Success by Mark Robert Waldman and Chris Manning PhD. (Jan.31, 2017). https://www.amazon.com/dp/B01N9BLBDH/ref=dp-kindle-redirect?_encoding=UTF8&btkr=1[xxxii] https://www.nimh.nih.gov/health/find-help/index.shtml
Here, I decided to put together their differences and similarities as I found to be useful to distinguish between each other, especially since they have different medical usage.
Whew! The recent Kion 5 Day Fast has now come to a close - and we had over 10,000 people participate (that's a whole lot of food that wasn't eaten). During the fast, I received plenty of questions about fasting, such as: Does coffee help or harm your fast? What can I do to improve my sleep during - and after - a fast? What is the hormonal effect of fasting on males? And what about for women? What is the best kind of fasting if your goal is body composition (fat loss, muscle gain/maintenance)? Does fasting - especially 3-5 day extended fasts - slow down your metabolism? What type of training is best while fasting, and what type of training should be avoided? What other things can you do to enhance the benefits of a fast? (e.g. cryotherapy, enemas, etc.) How should you prepare for - and break - an extended fast? Is it OK to fast while breastfeeding or pregnant? Does your ability to absorb food and supplements increase after a fast? What are your thoughts on EAAs while fasting? Do they break a fast? And what about BCAAs? And many more! So in today's episode, I dive into an official fasting Q&A solosode. Enjoy! Here are the questions I'll be answering: -How does fasting for longevity differ from fasting for things like fat loss or circadian rhythm...7:45 Decreasing calorie intake 20-40% is most optimal way to regulate aging and increase life span Inhibit mTOR pathway, stimulate autophagy, induce ketogenesis Autophagy: "self eating" - not to be confused with apoptosis, which is cell death Autophagosomes to lysosomes "spring cleaning in your cells" Eating shuts down autophagy; fasting increases autophagy mTOR: mammalian target of rapamycin Energy enzyme ATP becomes ADP Every time you eat, you activate mTOR and suppress autophagy Ketosis: using fat as the primary source of fuel Less oxidative stress; slows the aging process My personal protocol: 12-16 hour intermittent fast daily 24 hour fast (dinner to dinner) twice a month Fasting mimicking diet (FMD) 4x/year -Does coffee help or harm your fast...16:50 Black coffee can enhance fatty acid mobilization from adipose tissue, alertness, metabolism, Coffee without any calories added (coconut oil, butter, etc.) will help the fast -I don't sleep well when I fast...20:05 Carb intake at night (dinner time) assists with sleep Shut down the sympathetic nervous system to get to sleep while fasting You can get by on less sleep when you're fasting Don't forget the efficacy of breath work and meditation -What is the hormonal effect of fasting on males vs. females?...23:40 Lean and fit females do better with shorter fasts (12 hours); men are more versatile Insulin, growth hormone, responds favorably to a fast Noradrenaline increases with fasting Level of testosterone increase while fasting is unknown -Does fasting slow down your metabolism?...30:45 -What other things can you do to enhance the benefits of a fast?...33:20 Rock lotus extract Sauna sessions Cold thermogenesis -What type of training is best while fasting?...36:25 Anything that rapidly depletes glycogen or carb levels will have deleterious effects HIIT High weight, low reps; body building vs. weight lifting Walking, swimming, yoga; something you can do and have a conversation -How should you prepare for, and break, an extended fast?...38:55 When finished with a fast, you'll be less equipped to digest complex meals Go low and slow when reintroducing foods Soft cook veggies; Avocados, grass feed cottage cheese, eggs, No steaks; anything you need to chew for a long time -Is it okay to fast while breastfeeding or pregnant?...42:18 Religions encourage women to refrain from fasting while pregnant or breastfeeding Biochemical changes in milk in response to fasting Think "feast" not "famine" -Does your ability to absorb food and supplements increase after a fast?...45:38 Masszymes -Should I use amino acids to aid my fast?...48:15 Don't use them if your goal is cellular autophagy Can be very useful for resetting circadian rhythm, gut cleanup, spiritual benefits, etc. Can be a good mTOR activator Dry mouth, from amino acids: Spilanthes, electric berries Ginger, cayenne powder increases salivary production GI effects: -And much more! Resources from this episode: - - - - - Episode Sponsors: - Building blocks for muscle recovery, reduced cravings, better cognition, immunity, and more. Now in a DELICIOUS berry flavor! - After using the Joovv for close to 2 years, it's the only light therapy device I'd ever recommend. Give it a try: you won't be disappointed. Use my link when you order and get a FREE bonus gift! - When you introduce conscious, mindful gratitude into your day, positivity will begin to pour into your life – along with all the other scientifically proven physical, mental and spiritual benefits that go along with it. Do you have questions, thoughts or feedback for me? Leave your comments below and I'll reply!
The Cochrane Pain, Palliative and Supportive Care Group is producing a series of reviews on drugs for the treatment of people with fibromyalgia. One of these, published in March 2018, examines the effects of a class of antidepressants called serotonine noradrenaline reuptake inhibitors. In this podcast, one of the co-authors, Brian Walitt, from the National Institute of Nursing Research in the USA, describes the findings.
The Cochrane Pain, Palliative and Supportive Care Group is producing a series of reviews on drugs for the treatment of people with fibromyalgia. One of these, published in March 2018, examines the effects of a class of antidepressants called serotonine noradrenaline reuptake inhibitors. In this podcast, one of the co-authors, Brian Walitt, from the National Institute of Nursing Research in the USA, describes the findings.
The Cochrane Pain, Palliative and Supportive Care Group is producing a series of reviews on drugs for the treatment of people with fibromyalgia. One of these, published in March 2018, examines the effects of a class of antidepressants called serotonine noradrenaline reuptake inhibitors. In this podcast, one of the co-authors, Brian Walitt, from the National Institute of Nursing Research in the USA, describes the findings.
Ethan and Allie talk about adrenaline, the sickness that makes victory so sweet. Additional help from JJ Redick, Klay Thompson, Andre Iguodala and Draymond Green. Shout out to puking! 0:00- Introduction 1:00- Upcoming in this episode 2:30- Dumb Questions 4:30- What is Adrenaline 6:45- Noradrenaline vs Adrenaline 8:15- Evolution of Adrenaline 9:20- JJ Reddick 10:45- Pregame jitters 14:30- JJ Reddick 15:00- Andre Iguodala on matching Adrenaline 16:40- Iggy on positives and negatives of Adrenaline 17:15- Harnessing Adrenaline 19:05- Intensity of a game 21:20- Tachypsychia 25:50- Impact of fear on time 26:50- Unconscious decision making 28:00- Lingering Adrenaline 32:30- Adrenaline dumping 34:40- Draymond Green 35:40- Give and take of Adrenaline 36:20- Embracing fear 37:00- JJ Reddick on nerves 39:00- Usefulness of fear
In this dense and technical episode with Dr Tommy Wood, we introduce Hormetea! Why Hormetea? We love polyphenols - those magical compounds from plant foods that lend them their bright colours and multiple health benefits. The greens and yellows in tea, the deep orange of turmeric, and purples of berries. Many of these compounds provide some of their benefits by activating the metabolic machinery associated with fasting and autophagy - a process known as hormesis. To get all these great compounds in one place, we went into the kitchen and cooked up a tea - Hormetea. In one serving, you’ll find the best-researched plant polyphenols in doses that have been clinically-proven to reduce inflammation and improve metabolic health, with a touch of pepper to increase bioavailability. We’re sure you’re going to love it! We will send the first 100 people that leave us a 5-star review on iTunes (video instructions) a 50g sample of Hormetea. Please send your US shipping address to support@nourishbalancethrive.com About the Hormetea ingredients: Polyphenols Seem to be synergistic (i.e. EGCG inhibits the enzymes that metabolise quercetin) Anthocyanins (and quercetin) from bilberry Improves glucose tolerance in obese patients (when given with prebiotics) Improves disease score in UC (including reduced calprotectin) Reduces oxidative DNA damage Improves vascular function Improves gait speed and agility in the elderly Reduce insulin and glucose responses to carbs Inhibits MMPs (MS) Matcha - green tea catechins May help reduce fat mass (but requires synergism with caffeine, and may be better in caffeine naive) Improves insulin sensitivity Improves cognitive function in those with cognitive decline (with L-theanine) Reduces carbohydrate absorption (like anthocyanins) Grape seed extract Improves blood pressure and inflammation and glycaemic control in IR Reduces oxLDL Turmeric 1-5% curcumin Increase bioavailability with pepper Likely to not reach high systemic levels - use Meriva BUT 1-2g of turmeric can reduce CRP Improved working memory when given with carb load Rest is good for the gut Indigestion Increased intestinal ALP and reduced permeability? Broccoli seeds Highest content of sulforaphane Activated by heat (~160F) Lots of epidemiological studies on cruciferous veggies and cancer and all-cause mortality (another) But make sure you’re iodine-replete! Activates Nrf2 and antioxidant defence BrSp extracts are neuroprotective in rats Improves insulin resistance in T2DM Improved behaviour in ASD Improves 8-OHdG, GGT, and ALT in those with fatty liver Sign up for our Highlights email and every week we’ll send you a short (but sweet) email containing the following: One piece of simple, actionable advice to improve your health and performance, including the reference(s) to back it up. One item we read or saw in the health and fitness world recently that we would like to give a different perspective on, and why. One awesome thing that we think you’ll enjoy! Here’s the outline of this podcast with Tommy Wood, MD, PhD: [00:00:29] Icelandic Health Symposium. Tommy's talk from last year’s event. [00:02:25] This year’s event is called Who Wants to Live Forever. [00:02:41] Maryanne DeMasi was last year’s host, this year it’s Tommy! [00:02:55] Speakers: Ben Greenfield, Dr Bryan Walsh, Diana Rogers, Dr Dominic D’Agostino, Dr Doug McGuff, Dr Rangan Chatterjee, Dr Satchidananda Panda. [00:03:49] Speaker dinner. [00:03:58] Practitioner workshop. [00:04:59] Mountain biking in Iceland. [00:05:18] PHAT FIBRE, Wood, Thomas R., and Christopher Kelly. "Insulin, glucose and beta-hydroxybutyrate responses to a medium-chain triglyceride-based sports supplement: A pilot study." Journal of Insulin Resistance 2.1 (2017): 9. [00:06:46] PFv2 is more ketogenic (C8 oil). [00:07:01] Some glucose is required even in low-carb athletes. [00:07:37] Professor Kieran Clarke. [00:09:06] Testing nutritional supplements. [00:10:10] Professor Elizabeth Nance. [00:10:48] Hormetea. [00:11:14] Hormesis. [00:11:32] Plant polyphenols. [00:12:03] Rhonda Patrick, PhD. [00:13:28] Anthocyanins. [00:13:53] Root causes of MS talk. [00:16:02] Berries at the farmer's market. [00:16:53] Frozen berries can be found online. [00:17:19] Matcha green tea. [00:18:52] Grapeseed extract (not grapefruit seed extract). [00:20:38] Turmeric. [00:21:33] Meriva. [00:22:33] Broccoli sprouts. [00:24:03] Morning smoothie. [00:24:14] NRf2. [00:26:18] Hormesis in the metabolically deranged. [00:27:09] 8-hydroxy-2' -deoxyguanosine (8-OHdG). [00:28:12] Hormetea preparation instructions. [00:29:27] Video instructions for review. [00:31:57] Organic acids test (OAT). [00:32:24] Podcast: Bill Shaw, PhD. [00:33:35] Tommy's results: before and after. [00:33:46] Qualia (we have no financial affiliation). [00:35:21] PhD defence. [00:36:07] Acute stimulation then a come down. [00:38:23] MOA dopamine. [00:40:05] Professor Robert Sapolsky dopamine video. [00:42:05] Noradrenaline (because there ain’t no receptor for norepinephrine). [00:43:10] Serotonin. [00:44:28] Kyurinate and quinolinate. [00:44:56] 5-HTP [00:47:30] Book a free EPP Starter Session. [00:48:43] Model of encephalopathy of prematurity at the University of Washington. [00:53:53] Sign up for our Highlights email.
It all begins slowly. Heart beating faster, mouth drying up. Sweat starting to pour. Then next thing you know, you got stress bringing you down. It's a part of life and it's actually something we can control. Rather, people view it as something to bring people down. That Cheesy ‘Keep Calm and Carry On' design everywhere says how to deal with stress, but is it applicable? Might as well be shutting down and stop doing everything. Stress is complex because it affects so many areas and at different times. Yet so common situations that we've experienced since elementary school. Talking to your boss, performing something live, taking an exam all leads to stress that is called pre-performance stress. That's what stops us from being productive. Is it possible to look at stress as an actual advantage for your life? Taking those negative thoughts of anxiety and insecurity into excitement and focused motivation? Sounds too good to be true, but I'm going to show it's actually more attainable than you might think. Now scientifically, when we are stressed, our brains release a chemical called noradrenaline. Noradrenaline is both a good and a bad chemical to have. It increases arousal and alertness, but also increases anxiety and feeling tired. We actually need a healthy amount of that chemical or we're not working at our best. Ian Roberston, a cognitive neuroscientist at Trinity College Dublin said: There's a sweet spot of stress where you are right in the middle of what you need. Think of it has a Goldilocks zone of noradrenaline that it like a brain tuner. Noradrenaline essentially allows us to communicate with all our neural connections more smoothly. So that means if we can control and deal with our stress it actually be a boost in brain power. By increasing creativity and happiness, so we feel less of anxiety and depression. *So question is how do I deal with stressful situations to make this happen?* It all begins by rethinking the situation. Most of the symptoms I said previously, the heart racing, dry mouth, etc. are we get when we feel excitement. I said in previous episode about how self assurance talk can actually backfire. It's the same way. We feel anxiety before an important event or talking to someone of importance. This causes draining memory capacity, lower confidence, and overall harm in performance. Knowing this actually makes it worse. Anticipation of anxiety is used from the phrase ‘Calm down' as in Keep Calm and Carry On. Alison Wood Brooks, an assistant professor at Harvard Business School actually found out through studies that people who is able to not think ‘calm down' but rather viewed as a part of excitement. Stress and excitement both have arousal and a low sense of control. *Stress should be a challenge, not a burden.* Personal development is key focus in this mindset. As said by Stanford psychologist Carol Dweck which essentially means those who believe they can improve actually do. Feeling like you can't change is what's stopping negative thoughts and actions that prevent you from doing your best. Granted a possibility in failure can be seen as a negative, but also a chance to learn. This is how you turn stress into excitement and where the middle ground in actually improving performance. Comedians and other performers actually worry if they don't feel some level of anxiety before performance. Tiger Woods has spoken outwardly that he know's he's going to have a bad play if he doesn't feel it before he swings. This is how it ultimately becomes a performance enhancer. *Your mind is like a track – build it right* We've all know that negative thoughts of stress and anxiety go with us throughout our lives. It'll never fully be gone. Every single one of these thoughts are connections of neutral and chemical flows through our brain. The more the thought, the stronger the feeling. This is like a ski track in snow as said by Neuroscientist Alex Korb. Like swing, the more you go down the path, the easier it gets. Just like a mindset, the more you experience fear, anxiety, and self-doubt, the easier it gets going down that path. Now this can be resolved by what psychologists call ‘cognitive reappraisal'. This cognitive reappraisal is not ignoring negative thoughts, because let's face, is too difficult to completely remove. It's also not about turning these negatives into false positives such ‘People will love me'. It's all about looking at the bigger picture and using only realistic thoughts. Hooria Jazaieri, a licensed family therapist said The Wall Street Journal “I tell clients to think like a scientist. You are using your observations and descriptions about yourself non-judgmentally, observing and describing facts.” So instead of allowing a deep rabbit hole of negative thought. Take a moment to know what *is* happening and immediately stop. My suggestion is to write these thoughts down and then identify what triggers them. Did your boss sent you an email saying he needs to speak with me and instantly thought something terrible was going to happen? Write these things down and then toss them in a recycling bin. Be a scientist and challenge these thoughts like a hypothesis. Did you do not perform? Will you get fired because of it? Now when you think about these things, you're no longer thinking rationally. Always look for the evidence. What have you done well? Did you get a raise recently? Write those self doubting thoughts down. I've always said writing down increases memory and helps keep confidence in yourself. Keep on that ski course. What happens if it doesn't work? Then go as hard as you can. Do you think your work is the worst? Then tell yourself that. Tell yourself that there's never been a worse worker than you. There's no reason why anyone should hire you. Why? Because laughter said by Steve Orma, a clinical psychologist and author of Stop Worrying and Go To Sleep. Will always make you feel better. Which removes any negative thoughts. So you want to gain muscle? As it turns out it's not going to happen in one gym session. Your brain is just like that. It's a continuation of understanding and being proactive in your anxiety that can be used productivity. These aren't scary as they really are, we just make them worse than they really are. It's practice – just like all skills and it all begins with you and your thoughts.
JOLSID.com - An essential amino acid for our health is Phenylalanine, which we acquire from food. Our body changes phenylalanine in to tyrosine, which is non-essential amino acid that is used to make proteins and neurotransmitters or brain chemicals, including norepinephrine, epinephrine,dopamine, and thyroid hormones. Neurotransmitters help nerve cells communicate and influence mood. Tyrosine also helps in the function of organs responsible for making and regulating hormones, including the adrenal, thyroid, and pituitary glands. L-Tyrosine can also be metabolized into glucose and used for energy production. Tyrosine works as a converter for the neurotransmitter epinephrine, by converting it into an amino acid that is released from your adrenal gland. Epinephrine is more widely known as adrenalin, which we all know increases our heart rate and breathing. This in turn produces oxygen-rich blood that travels to your brain and muscles, which increases your energy, sharpens your senses, improves your memory, and decreases your pain sensitivity. Tyrosine produces epinephrine in times of stress or danger so you are better able to cope with the situation. Dopamine helps us stay motivated and assertive throughout the day. Tyrosine helps make this neurotransmitter. Dopamine allows your to deal with your daily stresses and problems. However, lack of sleep and too much stress can lower your dopamine levels, making your brain less active. One of the effects that Tyrosine supplementation has on our brain is cognitive improvements. It helps to reduce the effects of both stress and fatigue on cognitive task performance, which makes it easier for us to stay focused while studying or working for long periods of time. Research done at the Department of Clinical Neuropsychology at the University of Amsterdam studied the effects of the amino acid tyrosine on cognitive task performance on a group of 21 cadets during a demanding military combat training course. Ten subjects received a protein-rich drink containing 2g of tyrosine daily for five days, and the other 11 subjects were given a carbohydrate rich drink with the same amount of calories. Assessments were made of the cadets immediately prior to the combat course, and then on the 6th day of the course. The group supplied with the tyrosine-rich drink performed better on a memory and a tracking task than the group supplied with the carbohydrate-rich drink. These findings suggest that supplementation with tyrosine may, under operational circumstances characterized by psychosocial and physical stress, reduce the effects of stress and fatigue on cognitive task performance. Another effect of Tyrosine supplementation is that it can help protect us against the effects of stress. When we experience stress, our brains release noradrenaline, or norepinephrine, which is a neurotransmitter. Noradrenaline stimulates your central nervous system and increases your energy and mental power. It takes time for our bodies to replenish levels of noradrenaline once they are depleted, which can leave us feeling sluggish. Tyrosine increases the rate of noradrenaline synthesis so that you are less susceptible to stress and do not experience an energy crash. Another study conducted at the University of Amsterdam in the Department of Psychophysiology tested the effects of tyrosine on performance under stress on 16 healthy young subjects.Subjects were tested on two separate days, one test was given after ingestion of 100mg/kg tyrosine and another test after a placebo, in random order. The tests were performing a number of stress sensitive tasks. Subjects were exposed to a stressor consisting of 90 dB noise. Tyrosine was found to improve the performance on two cognitive tasks, which were performed 1 hour after administration of tyrosine and which could be characterized as highly sensitive to stress. How to Supplement with Tyrosine For general needs, you should be getting 47 mg (0.047g) of tyrosine for every 1 g of protein in your diet according to the Food and Nutrition Board of the Institute of Medicine. In 2007 in the Journal of Psychiatry and Neuroscience researchers discovered that most studies used anywhere from 2 to 20 grams of tyrosine daily for stress reduction and improved cognitive function Caution: It may raise thyroid hormone production since it is a precursor for its synthesis, so those with a hyperactive thyroid should be wary Additionally, it could theoretically block the uptake from the gut of some drugs that resemble certain amino acids such as levodopa
Part 1 of a TWO part podcast. Today’s episode we go through Acetylcholine, Noradrenaline, Dopamine, Serotonin, Histamine and Nitric Oxide.
This is a discussion on the use of early, peripheral vasopressors in patients with septic shock. The core messages: - limit fluids - use vasopressors earlier / synergistically with IV fluids - Use Noradrenaline - use it peripherally (ie. through a good, watched, flowing IVC - idealaly proxiaml to the elbow. - think about the use of CVCs and potential harms / benefits in small hospitals.
Insights into tragedy. The Emperor has no clothes. Why do we medicate everything and get sicker mentally emotionally, physically and spiritually? "Three days before 20-year-old Adam Lanza killed his mother, then opened fire on a classroom full of Connecticut kindergartners, my 13-year-old son Michael (name changed) missed his bus because he was wearing the wrong color pants." Read more: http://gawker.com/5968818/i-am-adam-lanzas-mother When you look below the surface at the specialty of psychiatry what you uncover is so ludicrous it is difficult to believe that it is really true. Prominent psychiatrists from all over the world gather annually for a meeting at which new diseases are invented. There are no objective findings that establish the diagnosis of these diseases. http://www.life-enthusiast.com/index/Concerns/Autism_ADHD/Psychiatry_Scientific_Dangerous From the book "Surviving the Toxic Crisis" by William R. Kellas Accumulation of Mercury in the brain leads to mental and nervous system effects such as brain fog, depression, vision difficulties, and others as listed above. Mental effects are among the most common due to mercury's strong affinity for the brain. Mercury inhibits the effects of certain neurotransmitters: Dopamine: controls pain, well-being Serotonin: relaxation, sleep, well-being Adrenaline: energy and stamina Noradrenaline, melatonin: sleep cycles Inhibition of these neurotransmitters by mercury can account in part for the feelings of depression and loss of motivation. http://www.life-enthusiast.com/index/Concerns/Autism_ADHD/Mercury_Influences_Body_Chemistry Toxins Related to Inherited Disease PULLMAN, Wash. -- A disease you are suffering today could be a result of your great-grandmother being exposed to an environmental toxin during pregnancy. Researchers at Washington State University reached that remarkable conclusion after finding that environmental toxins can alter the activity of an animal's genes in a way that is transmitted through at least four generations after the exposure. http://www.life-enthusiast.com/index/Health_Education/Toxicity/Toxins_Related_Inherited_Disease
The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.
Noradrenaline release from rat brain cortical synaptosomes permeabilized with streptolysin O can be triggered by μM concentrations of free Ca2+. This process was inhibited within minutes by tetanus toxin and its isolated light chain, but not by its heavy chain. The data demonstrate that the effect of tetanus toxin on NA release from purified synaptosomes is caused by the intraterminal action of its light chain.