Podcasts about ncbi

  • 129PODCASTS
  • 300EPISODES
  • 55mAVG DURATION
  • ?INFREQUENT EPISODES
  • Jul 22, 2026LATEST

POPULARITY

20192020202120222023202420252026


Best podcasts about ncbi

Latest podcast episodes about ncbi

Master Your Marriage
Breaking the Silent Treatment: How to End the Silence and Reconnect in Your Marriage

Master Your Marriage

Play Episode Listen Later Jul 22, 2026 24:47


We've all heard (or said) those loaded words: “We need to talk.” For most of us, they immediately trigger defensiveness and dread. But what happens when conversations stop altogether? In this replay episode, we explore the difference between healthy silence and the damaging silent treatment, why it's so harmful to your marriage, and practical ways to break the silence and start reconnecting.Whether you're currently experiencing emotional distance, stonewalling, or a full-blown demand-withdrawal pattern, this conversation offers hope and actionable steps. We discuss real client situations, common pitfalls, and how to approach hard topics without triggering another fight.Key Topics Covered:The critical difference between a productive “adult time-out” and the silent treatmentHow the silent treatment functions as a form of emotional control or abuseWhy research shows the silent treatment activates the same brain areas as physical painPractical scripts and strategies to name the silence and turn toward each other againThe power of “I” statements and acknowledging fear to rebuild connectionIf silence has been growing in your relationship, this episode will help you take that first brave step back toward one another.Key TakeawaysSilence can be golden when it's a mutual agreement to revisit the conversation later. The silent treatment is a refusal to engage at all.The silent treatment leaves the other person feeling rejected, unimportant, and unloved — and over time it erodes trust and intimacy.Avoiding conflict doesn't work. Unspoken issues build until there's no emotional energy left to fight for the marriage.The best way to break the silence is to name it out loud, using vulnerable “I” statements and acknowledging your fears.Small, consistent efforts to turn toward each other are what keep couples from drifting apart.Resources & Further ReadingMeta-analysis on the demand/withdraw pattern: Schrodt, P., Witt, P., & Shimkowski, J. (2014). Communication MonographsAdditional research: NCBI article on the silent treatment and its effectsConnect With UsWebsite: MasterYourMarriage.usInstagram: @masteryourmarriageFacebook: Master Your MarriageLooking for personalized support? Schedule a free 30-minute discovery call at masteryourmarriage.us — we work with couples ready to do the real work of repair.Mentioned in this episode:Research Interview RequestBefore we get back to the episode, I want to share something quick. A lot of people who listen here are looking for more support than the podcast alone can offer. Some are interested in coaching, but many want a more structured program with clear tools and ongoing guidance. We're in the early stages of creating something like that right now, and we're looking for a few people to interview so we can make sure we get it right. If you've ever felt successful in your career but disconnected at home, I'd really love to talk with you to get your insights as we create something that can genuinely help couples. This is purely for research — no sales pitch, no pressure. If you're interested, go to masteryourmarriage.us/research to schedule a quick interview.” Alright…back to the episode

Not Just a Chiropractor for Stamford, Darien, Norwalk and New Canaan
Don't Wait: The Hidden Costs of Delaying Neuropathy Care

Not Just a Chiropractor for Stamford, Darien, Norwalk and New Canaan

Play Episode Listen Later Sep 9, 2025 9:11


Neuropathyct.com1) Symptoms usually creep forward More numbness, burning, pins-and-needles, and sensitivity changes over time. (NINDS)2) Sleep gets hammered Neuropathic pain commonly disrupts sleep, which then worsens pain perception the next day. (ScienceDirect, PMC)3) Balance confidence drops; fall risk rises Loss of sensation and vibration sense increases falls and near-falls—especially in older adults. (PMC, PubMed, Frontiers)4) Foot problems can snowball (especially with diabetes) Delayed care → unnoticed injuries/ulcers → infection → higher chance of amputation if things progress. (NCBI, PMC)5) Daily function and quality of life shrink People report limits in walking, standing, hobbies, and overall well-being. Mood and anxiety often worsen. (Nature, PMC)6) Heavier reliance on pain meds without addressing nerve function Drugs like gabapentin/pregabalin/duloxetine may help pain for some, but results vary and they don't restore nerve function. (Patients should never change meds without their prescriber.) (ScienceDirect, Mayo Clinic Proceedings, PMC)7) Hidden injuries are easier to miss Reduced sensation means burns, cuts, or shoe-related wounds can go unnoticed and worsen. (This podcast welcomes your feedback here are several ways to reach out to me. If you have a topic you would like to hear about send me a message. I appreciate your listening. Dr. Brian Mc Kayhttps://twitter.com/DarienChiro/https://www.facebook.com/ChiropractorBrianMckayhttps://chiropractor-darien-dr-brian-mckay.business.sitehttps://podcasts.apple.com/us/podcast/not-just-chiropractor-for-stamford-darien-norwalk-new/id1503674397?uo=4Core Health Darien-Dr.Brian Mc Kay 551 Post RoadDarien CT 06820203-656-363641.0833695 -73.46652073GMP+87 Darien, Connecticuthttps://youtu.be/WpA__dDF0O041.0834196 -73.46423349999999https://darienchiropractor.comhttps://darienchiropractor.com/darien/darien-ct-understanding-pain/Find us on Social Mediahttps://chiropractor-darien-dr-brian-mckay.business.site https://www.youtube.com/channel/UCNHc0Hn85Iiet56oGUpX8rwhttps://docs.google.com/spreadsheets/d/1nJ9wlvg2Tne8257paDkkIBEyIz-oZZYy/edit#gid=517721981https://goo.gl/maps/js6hGWvcwHKBGCZ88https://www.youtube.com/my_videos?o=Uhttps://www.linkedin.com/in/darienchiropractorhttps://www.facebook.com/ChiropractorBrianMckayhttps://sites.google.com/view/corehealthdarien/https://sites.google.com/view/corehealthdarien/home

Regulated & Relational
Ep 101: What you need to know about Attachment Disorders

Regulated & Relational

Play Episode Listen Later Aug 26, 2025 56:17


In this foundational episode of Regulated & Relational, Ginger and Julie dive deep into attachment disorders—what they are, how they're diagnosed, and the realities families face when raising children with these challenges.From the history of Reactive Attachment Disorder (RAD) and Disinhibited Social Engagement Disorder (DSED) to the proposed Developmental Trauma Disorder (DTD), Ginger and Julie unpack decades of evolving research, personal experience, and practical tools for caregivers and professionals. They also address the hallmark behaviors—like manipulation, triangulation, lack of empathy—and explore why these behaviors occur, and how to respond in ways that promote healing and connection.This conversation is both honest and hopeful—acknowledging the challenges while sharing effective therapeutic parenting strategies, the importance of pacing and dosing nurture, and the long-term potential for growth and change.The history and evolution of attachment disorder diagnoses in the DSMHow RAD and DSED differ—and why splitting the diagnosis has caused confusionPrevalence rates and why research has been limitedHow attachment disorders can be mistaken for, or co-exist with, autismThe why behind hallmark behaviors:Manipulation and controlTriangulation between adultsLack of cause-and-effect thinkingLow empathyTherapeutic parenting strategies, including:Offering limited, safe choicesMaking implicit care explicitPacing and dosing nurture to build trustReducing chaos and avoiding power strugglesWhy Developmental Trauma Disorder matters—and how it may fill gaps in our understanding of trauma's impact on childrenHopeful outcomes and the critical importance of early intervention and ongoing supportAttachment & Trauma Network: www.attachmenttraumanetwork.orgNational Institute of Health prevalence statistics (2023)Reactive Attachment Disorder - StatPearls - NCBI Bookshelf: https://www.ncbi.nlm.nih.gov/books/NBK537155/ (Published: May 1, 2023)Introduction to children's attachment - NCBI: https://www.ncbi.nlm.nih.gov/books/NBK356196/ https://www.ncbi.nlm.nih.gov/books/NBK537155/#:~:text=Epidemiology,Adolescent%20Well%2DBeing%2C%20No.Research on RAD subtypes: Dr. Charles Zeanah (2004)https://pmc.ncbi.nlm.nih.gov/articles/PMC4342270/ACEs Study: CDC ACEs Resources

City Limits
¿Cómo han afectado los despidos a los latinos en cargos federales?

City Limits

Play Episode Listen Later Mar 17, 2025 22:11


Miles de trabajadores federales han sufrido cambios en su situación laboral, ya sea porque fueron despedidos, puestos en suspensión o destituidos, desde que el presidente Donald Trump asumió el cargo en enero y creó el Departamento de Eficiencia Gubernamental (DOGE por sus siglas en inglés), que se ha encaprichado en reducir la fuerza laboral federal bajo el mando de Elon Musk. Si bien la presencia de trabajadores blancos y negros en el gobierno federal es mayoritaria, los latinos están poco representados. Según USA Facts, los latinos representan el 18.9 por ciento de la población estadounidense, pero representan el 9.5 por ciento de la plantilla del gobierno federal. Susany Acosta trabajó en la Biblioteca Nacional de Medicina (NLM por sus siglas en inglés) por los últimos tres años como analista de programas de apoyo a los repositorios de datos del Centro Nacional para la Información Biotecnológica (National Center for Biotechnology Information o NCBI por sus siglas en inglés) de la biblioteca. Así que para hablar de su trabajo, del despido y de cómo se han organizado los trabajadores federales despedidos, invitamos a Acosta.

Agent Survival Guide Podcast
2025 ACA Open Enrollment Hits All-Time High

Agent Survival Guide Podcast

Play Episode Listen Later Jan 24, 2025 11:11


  The Friday Five for January 24, 2025: Regulatory Freeze TikTok Ban Update Instagram Announces Edits Optimal Ambient Temperature for Seniors 2025 ACA Enrollment Hits All-Time High   Contact the Agent Survival Guide Podcast! Email us ASGPodcast@Ritterim.com or call 1-717-562-7211 and leave a voicemail.   Regulatory Freeze: Isaac, Mike. “Instagram Debuts New Video-Editing App, as TikTok Deals With a Ban.” Nytimes.Com, The New York Times, 19 Jan. 2025, www.nytimes.com/2025/01/19/technology/instagram-video-app-tiktok-ban.html. “Regulatory Freeze Pending Review.” Whitehouse.Gov, The United States Government, 20 Jan. 2025, www.whitehouse.gov/presidential-actions/2025/01/regulatory-freeze-pending-review/. Treisman, Rachel. “Trump Is Signing a Flurry of Executive Orders. Here's How Those Work.” Npr.Org, NPR, 21 Jan. 2025, www.npr.org/2025/01/21/nx-s1-5269600/trump-executive-actions-orders-memoranda-proclamation.   TikTok Ban Update: “Application of Protecting Americans from Foreign Adversary Controlled Applications Act to TikTok.” Whitehouse.Gov, The United States Government, 21 Jan. 2025, www.whitehouse.gov/presidential-actions/2025/01/application-of-protecting-americans-from-foreign-adversary-controlled-applications-act-to-tiktok/. Duffy, Clare, and David Goldman. “TikTok Is Back Online after Trump Pledged to Restore It.” Cnn.Com, CNN, 20 Jan. 2025, www.cnn.com/2025/01/19/tech/tiktok-ban/index.html. Allyn, Bobby. “TikTok Is Back Online in the U.S., Following Trump's Promise to Pause the Ban.” Npr.Org, NPR, 19 Jan. 2025, www.npr.org/2025/01/19/nx-s1-5267568/tiktok-back-online. Lagatta, Eric. “TikTok Still Not Available on App Stores after Trump's Executive Order: What We Know.” USA Today, Gannett Satellite Information Network, 22 Jan. 2025, www.usatoday.com/story/tech/2025/01/22/tiktok-ban-download-app-stores-update/77872210007/.   Instagram Announces Edits: Davis, Wes. “Instagram Announces a Blatant CapCut Clone.” Theverge.Com, The Verge, 19 Jan. 2025, www.theverge.com/2025/1/19/24347358/instagram-edits-capcut-video-app-tiktok-ban. Schoon, Ben. “Instagram ‘edits' Coming to Android in February as CapCut Remains Banned.” 9to5google.Com, 9 To 5 Google, 20 Jan. 2025, 9to5google.com/2025/01/20/instagram-edits-app-android-february/.   Optimal Home Temperature for Senior Brain Health: Pappas, Stephanie. “How Heat Affects the Mind.” Apa.Org, American Psychological Association, 1 June 2024, https://www.apa.org/monitor/2024/06/heat-affects-mental-health. “Home Ambient Temperature and Self-Reported Attention in Community-Dwelling Older Adults.” Pubmed.Ncbi.Nlm.Nih.Gov, U.S. National Library of Medicine, 3 Dec. 2024, pubmed.ncbi.nlm.nih.gov/39656181/. “Indoor Temperatures Affect Cognitive Function in Older Adults.” Neurosciencenews.Com, Neuroscience News, 14 Jan. 2025, neurosciencenews.com/temperature-aging-cognition-28353/. Thompson, Dennis. “Is Your Home Too Warm for Seniors' Brain Health?” Healthday.Com, HealthDay, 16 Jan. 2025, www.healthday.com/health-news/senior-health/is-your-home-too-warm-for-seniors-brain-health. “Scientists Warn: Your Home Temperature Could Be Increasing Your Risk of Cognitive Decline.” SciTechDaily.Com, SciTechDaily, 22 Jan. 2025, scitechdaily.com/scientists-warn-your-home-temperature-could-be-increasing-your-risk-of-cognitive-decline/.   2025 ACA Enrollment Hits All-Time High: Pifer, Rebecca. “ACA Enrollment Breaks Records Again in 2025.” Healthcaredive.Com, Healthcare Dive, 21 Jan. 2025, www.healthcaredive.com/news/aca-enrollment-2025-record-high-final/737679/. “Over 24 Million Consumers Selected Affordable Health Coverage in ACA Marketplace for 2025.” CMS.Gov, Centers for Medicare & Medicaid Services, 17 Jan. 2025, www.cms.gov/newsroom/press-releases/over-24-million-consumers-selected-affordable-health-coverage-aca-marketplace-2025. “State-Based Marketplaces: 2025 Open Enrollment.” Cms.Gov, Centers for Medicare & Medicaid Services, www.cms.gov/files/document/state-exchange-oe-chart-py-2025.pdf. Accessed 22 Jan. 2025.   Resources: 5 Business Podcasts to Follow: https://lnk.to/asg636 8 Strategies to Prevent Rapid Disenrollments from Medicare Plans: https://lnk.to/asg641 CMS Draft Legislation for CY 2026: https://lnk.to/asgf20250117 How Relationship Marketing Can Make the Difference in Your Agency: https://lnk.to/asg642 Why Gen Z is a Good Fit for Selling Insurance: https://lnk.to/asg640   Follow Us on Social! Ritter on Facebook, https://www.facebook.com/RitterIM Instagram, https://www.instagram.com/ritter.insurance.marketing/ LinkedIn, https://www.linkedin.com/company/ritter-insurance-marketing TikTok, https://www.tiktok.com/@ritterim X, https://twitter.com/RitterIM and Youtube, https://www.youtube.com/user/RitterInsurance     Sarah on LinkedIn, https://www.linkedin.com/in/sjrueppel/ Instagram, https://www.instagram.com/thesarahjrueppel/ and Threads, https://www.threads.net/@thesarahjrueppel  Tina on LinkedIn, https://www.linkedin.com/in/tina-lamoreux-6384b7199/   Not affiliated with or endorsed by Medicare or any government agency.

Inspirational Visions
Lead with Love in a Difficult Situation!

Inspirational Visions

Play Episode Listen Later Aug 14, 2024 16:16


Our monthly podcast has a new look, a new format and a short 15-minute listen! Listen in NOW for encouraging deep questions that will positively impact your life. We are excited to embark on this journey with you! Thank you for tuning in! In this strong 15-minute space… we invite you to pause, breathe, listen, and grow! This captivating conversation is about how responding from a place of love in any difficult situation expands your life! “Practice the Pause” and your self-limiting beliefs rebuild. You have relationships and specific situations in your life that are a struggle. How can you best overcome the obstacles that inevitably arise? We will show you how! Let yourself feel differently, think differently and express yourself naturally while you successfully repair a difficult situation. We dive into tips on leading from your heart and how to begin cleaning up tough demands within your life that matter to you! No matter the situation you always have the power of love with you! It's that simple, it's that powerful! Join us for future monthly upcoming episodes. We would love to hear from you. Please rate, review, and subscribe to this podcast for more empowering content. Share with those who might benefit! Connect with us through social media! Podcast Resources: 1. YourTango.com 2. Putting Relationship First 3. I and Me from NCBI article

Creating Divine Conversations with Jess & Mary
Lead with Love in a Difficult Situation!

Creating Divine Conversations with Jess & Mary

Play Episode Listen Later Aug 14, 2024 16:16


Our monthly podcast has a new look, a new format and a short 15-minute listen! Listen in NOW for encouraging deep questions that will positively impact your life. We are excited to embark on this journey with you! Thank you for tuning in! In this strong 15-minute space… we invite you to pause, breathe, listen, and grow! This captivating conversation is about how responding from a place of love in any difficult situation expands your life! “Practice the Pause” and your self-limiting beliefs rebuild. You have relationships and specific situations in your life that are a struggle. How can you best overcome the obstacles that inevitably arise? We will show you how! Let yourself feel differently, think differently and express yourself naturally while you successfully repair a difficult situation. We dive into tips on leading from your heart and how to begin cleaning up tough demands within your life that matter to you! No matter the situation you always have the power of love with you! It's that simple, it's that powerful! Join us for future monthly upcoming episodes. We would love to hear from you. Please rate, review, and subscribe to this podcast for more empowering content. Share with those who might benefit! Connect with us through social media! Podcast Resources: 1. YourTango.com 2. Putting Relationship First 3. I and Me from NCBI article

Fix Your Sciatica Podcast
Does Everything Work for Sciatica Pain?

Fix Your Sciatica Podcast

Play Episode Listen Later Aug 8, 2024 7:48


Over the years I've come across articles touting very strange modalities and treatments for nerve pain: supplements, apple cider vinegar, ultrasound… But do they actually work? Maybe. If you come across research articles about specific treatments, there may be 1 or 2 people in the sample group that did benefit, but compared to the rest of the group, it may not have been effective at all. So we need to look at treatment modalities with a careful eye, but ultimately comparing its effectiveness with how you feel. You can search for any specific modality and the research behind it by searching: sciatica, modality (of your choice) and the letters “NCBI”. You'll find the research to support or refute it.Regardless of modality, treating pain is a scientific process starting with an educated guess. Let your symptoms and progress be your guide in picking which one actually works for you.Here's the link for our butt pain podcast: https://podcasts.apple.com/us/podcast/fix-your-sciatica-podcast/id1563055005?i=1000664005663Did you know that our YouTube channel has a growing number of videos including this podcast? Give us a follow here- https://youtube.com/@fixyoursciatica?si=1svrz6M7RsnFaswNAre you looking for a more affordable way to manage your pain? Check out the patient advocate program here: ptpatientadvocate.comHere's the self cheat sheet for symptom management: https://ifixyoursciatica.gymleadmachine.co/self-treatment-cheat-sheet-8707Support this podcast at — https://redcircle.com/fix-your-sciatica-podcast/donationsAdvertising Inquiries: https://redcircle.com/brandsPrivacy & Opt-Out: https://redcircle.com/privacy

Copywriting For Coaches
The Five Best Books For Online Entrepreneurs To Read This Summer

Copywriting For Coaches

Play Episode Listen Later Jun 25, 2024 18:13


This is not your typical entrepreneur book recommendation list. You will not find these in the business section of your local bookstore. But they have profoundly and positively affected me as both a copywriter and a business owner. Because sometimes you need to see from a different perspective - one that is not typical business advice that you've heard a million times before at this point. You'll be pleasantly surprised by this unusual book list for business owners to read.I've got a book for when you need to: just sit down and write, write but you don't have time, Be reminded of the Big Picture importance of copywriting from a neuropsychology perspectiveDevelop the most important copywriting skill in a fun and relaxed wayI've thoughtfully curated the five best books for online entrepreneurs to read this summer. So add them to your GoodReads, request them from your local library, or treat yourself to time at your favorite bookstore to pick up these books. 0:08:04 - Key lessons on the writing process. 0:10:25 - Encouragement for mothers to prioritize creative work.0:11:23 - Advocating for intentional digital minimalism.0:12:24 - Countering busyness and the myth of not having enough time.0:13:43 - Benefits of reading fiction.EPISODES AND LINKS MENTIONED:Links to all book recommendations can be found here.Big Think shares it in a way that is easier to digest. They said that “Modern research suggests that reading fiction helps you neurologically relate to other people's experiences. It also correlates with improved social interactions and the ability to read the room.” Here is the actual scholarly article from NCBI. Research suggests that reading literary fiction improves one's theory of mind and emotional intelligence.Reese's Book ClubCONNECT WITH MEGAN:Join My Inbox Community → www.megankachigan.com/emailWebsite → www.megankachigan.comFacebook → https://www.facebook.com/megan.kachiganLinkedIn → https://www.linkedin.com/in/megan-kachigan-loehr-9957684b/Threads → https://www.threads.net/@megankachiganAsk a question for the podcast → https://forms.gle/9rPT7dtAKQCErzUg6WORK WITH ME: Download the Services GuideGet my Starter Doc for your copy project when you book a Power HourPrefer to read this episode as a blog? It is published here https://www.megankachigan.com/five-best-books-for-online-entrepreneurs-to-read-this-summerIf you are enjoying these episodes, please rate and review so that I can continue to provide you top-quality free content. Simply scroll to “Copywriting For Coaches” on Apple Podcasts, select a 5-star rating, and tap “write a review.” Thank you!

The Sharvette Mitchell Radio Show
Event spotlight with Dr. Yemaja Jubilee JULY JUBILEE JUNETEENTH CELEBRATION

The Sharvette Mitchell Radio Show

Play Episode Listen Later Jun 4, 2024 36:00


The Sharvette Mitchell Radio Show | www.Sharvette.com | EveryTuesday Tune in as we chat with Dr. Yemaja Jubilee about the upcoming JULY JUBILEE JUNETEENTH CELEBRATION featuring Dr. Opal Lee, the Grandmother of Juneteenth!   JULY JUBILEE JUNETEENTH CELEBRATION July 5 -7, 2024 Twin Lakes State Park  bit.ly/twinlakesjuneteenth The rich history of the Connect, Communicate, & Collaborate Team (CCC Team) was formed in September 2023 by Dr. Yemaja Jubilee. Her father, 98-year-old Rev. John Henry Brown, (Charlotte County, VA) a member of the 1390 Black Battalion, Civilian Conservation Corps, helped build the dams for the 1930s segregated Prince Edward Lake (Black recreation park) and Goodwin Lakes (White recreation park). The Civil Rights Acts of 1964 legally ended segregation; however, in 1986, the Park was integrated and renamed Twin Lakes. A ceremony honoring Rev. Brown was held at Twin Lakes in June 2023. Following Dr. Jubilee's production of this celebration, she had a vision to invite Dr. Opal Lee, the grandmother of Juneteenth, Fort Worth, Texas, to be the guest speaker at the 2024 Juneteenth Celebration. In collaboration with Kevin Faubion, Park Director at Twin Lake State Park, and The Friends of Twin Lakes State Park a 501(c)(3) organization, Dr. Jubilee began the uphill task of working together to bring her vision to fruition.    --- Dr. Jubilee is an Inspirational Speaker, SOUL-FULL POET/ SPOKEN WORD ARTIST, Life Coach, author, Creative Consultant, and song writer. She is an Inclusivity & Diversity Consultant through NCBI. As a renown inspirational speaker/workshop facilitator, Dr. Jubilee spreads her message of love and inclusivity.     

The Ziglar Show
A Guide To The Most Beneficial Fats For Your Drive

The Ziglar Show

Play Episode Listen Later May 10, 2024 63:15


As your body is the physical vehicle for all you do here on earth, this episode is about having it in great working order. As we continue to look at the best foods to fuel our bodies, we now turn to fat. Most of grew up where fat was the enemy, so everything went to no fat or zero fat and we Americans got…fatter. As quoted by the NCBI, National Center for Biotechnology Information: The prevalence of obesity changed relatively little during the 1960s and 1970s, but it increased sharply over the ensuing decades—from 13.4% in 1980 to 34.3% in 2008 among adults and from 5% to 17% among children during the same period. Then...the national adult obesity rate has increased by 26 percent since 2008 and today the U.S. adult obesity rate stands at 42.4 percent, the first time the national rate has passed the 40 percent mark. No fat has made us fat. Now let me clarify; a pint of Ben & Jerry's is 16 oz, and if I have it, I eat it all. The whole pint. A pint of Chubby Hubby has 1,320 calories and 80g of fat. A 16 oz slab of salmon has 944 calories and 59g of fat. However that Ben & Jerry's Chubby Hubby also packs in 140g of sugar and the salmon has zero. The fat you want is from fish, meat, olives, avocado, seeds and nuts, and some dairy...but not the Ben & Jerry's kind. Stay tuned and we'll help you decipher what fast will serve you best. Head to airdoctorpro.com and use promo code KEVIN and depending on the model receive UP TO 39% off or UP TO $300 off! Sign up for a one-dollar-per-month trial period at shopify.com/kevin Use promo code KEVIN today at shipstation.com to sign up for your FREE 60-day trial. Go to Seed.com/DRIVE and use code DRIVE to get 25% off your first month  Available Nationally, look for a bottle of Heaven Hill Bottled-in-Bond at your local store. Find out more at heavenhilldistillery.com/hh-bottled-in-bond.php Go to https://prolonlife.com/kevin and get TEN PERCENT off Prolon Life's 5-day nutrition program For comprehensive financial news and analysis, visit YahooFinance.com Learn more about your ad choices. Visit megaphone.fm/adchoices

Strange Country
Strange Country Ep. 281: Quest for Immortality

Strange Country

Play Episode Listen Later Apr 25, 2024 58:38


Charles Lindbergh wasn't only known for that flight, his weird reverence for Nazis and being the public face of America First, he was also interested in literal immortality. In the 1930s, he collaborated with Dr. Alexis Carrel to devise ways to regenerate organs so people could possibly live forever, but not just any people. It's the 1930s and these two white guys are mainly interested in elongating the lives of other white western dudes. Join Strange Country cohosts Beth and Kelly as they share another Lindbergh story and discuss whether they would want to live forever. Theme music: Big White Lie by A Cast of Thousands. Cite your sources: Dodes, Rachel. “The One-Body Problem.” Vanity Fair, no. 755, February 2024, 62-67, 97-99.   Friedman, David M. The Immortalists: Charles Lindbergh, Dr. Alexis Carrel, and Their Daring Quest to Live Forever. HarperCollins, 2008.   Harding, Luke. “DNA backs Lindbergh family claim | World news.” The Guardian, 28 November 2003, https://www.theguardian.com/world/2003/nov/29/germany.usa?CMP=gu_com. Accessed 29 March 2024.   Jehangir, Waqas. “Evolution of Artificial Hearts: An Overview and History.” NCBI, 6 October 2014, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5358116/. Accessed 16 March 2024.   Mark, Joshua J. “Gilgamesh.” World History Encyclopedia, 15 December 2022, https://www.worldhistory.org/gilgamesh/. Accessed 3 March 2024.   Stein, Rob. “First human transplant of a genetically modified pig kidney performed.” NPR, 21 March 2024, https://www.npr.org/sections/health-shots/2024/03/21/1239790816/first-pig-kidney-human-transplant. Accessed 23 March 2024.   Tully, Tracey. “The Lindbergh Baby Kidnapping: A Grisly Theory and a Renewed Debate.” The New York Times, 6 March 2024, https://www.nytimes.com/2024/03/05/nyregion/charles-lindbergh-baby.html. Accessed 24 March 2024.   Velie, Marissa Sertich. “What's the Difference Between Dutch Process and Natural Cocoa Powder?” Serious Eats, https://www.seriouseats.com/difference-dutch-process-natural-cocoa-powder-substitute. Accessed 3 March 2024.

Input
Antisemitismus & Islamophobie: Wie geht Zivilcourage?

Input

Play Episode Listen Later Apr 17, 2024 37:12


In Zürich wird ein orthodoxer Jude mit einem Messer angegriffen und schwer verletzt. Auch muslimische Gemeinschaften berichten von einer Zunahme von Übergriffen auf offener Strasse. Was bedeutet dieser Anstieg von Hassverbrechen für uns als Zivilgesellschaft? Samstag Abend, anfangs März: Ein Teenager, mutmasslich islamistisch radikalisiert, greift in Zürich Wiedikon einen jüdischen Mann auf offener Strasse mit einem Messer an. Einem Jiu-Jitsu-Kampfsportler, zufällig in einem angrenzenden Restaurant, gelingt es schliesslich, den Angreifer zu überwältigen. Kurze Zeit später werden in Bad Ragaz zwei muslimische Männer vor ihrer Wohnungstür mit einer Machete angegriffen und verletzt – die Opfer gehen von einer anti-islamisch motivierten Tat aus. Ein Schock geht sowohl durch die jüdische, als auch die muslimische Gemeinschaft in der Schweiz. Input-Autorin Julia Lüscher bleibt mit der Frage zurück: Was würde ich tun, wenn ich in so eine Szene geriete? Wie kann ich mich zivilcouragiert verhalten – ohne mich selber zu gefährden? _ In dieser Sendung zu hören:  - Ebnomer Taha, Vorstandsmitglied VIOZ, Verein Islamischer Organisationen Zürich, muslimischer Seelsorger Unispital Zürich und Psychiatrische Uniklinik Zürich - Jonathan Kreutner, Generalsekretär Schweizerisch-Israelitischen Gemeindebund SIG - Andi Geu, Co-Geschäftsführer NCBI, NGO Antirassismus, Antisemitismus und Interreligiöser Dialog - Johannes Ullrich, Professor für Sozialpsychologie, Universität Zürich 02:00 Zäsur: Jonathan Kreutner über Messerangriff in Zürich im März 23 07:50 Mehr Angriffe auf Muslime: Ebnomer Taha 11:27 So funktioniert Zivilcourage: Johannes Ullrich, Professur für Sozialpsychologie 18:04 Andreas Geu, Coach für Zivilcourage.  _ Links:  - Antisemitismusbericht Swissjews 2023: https://swissjews.ch/de/downloads/berichte/antisemitismusbericht2023 - Diskriminierungsbericht Stiftung gegen Antisemitismus und Rassismus GRA: https://www.gra.ch/diskriminierungsbericht-2023/ Input  - Zahlen Bundesamt für Statistik: Vorurteile gegenüber Mindeheiten: www.bfs.admin.ch/bfs/de/home/statistiken/bevoelkerung/migration-integration/zusammenleben-schweiz/einstellungen-zielgruppen.html _ Autorin: Julia Lüscher

Absolute Gene-ius
The Bioinformatic artistry behind PCR assay design

Absolute Gene-ius

Play Episode Listen Later Mar 13, 2024 34:49


Designing a successful PCR assay is all about selecting the right primers to deliver the sensitivity and selectivity for which PCR is known for. But anyone that's designed an assay themselves will know that doing so successfully is a lot harder it sounds. We're joined by two PCR assay design pros for this episode. Kimi Soohoo Ong, and Dr. Rounak Feigelman, both from Thermo Fisher Scientific, shine a light on the many factors that must be considered to design a winning PCR assay. From the level of fragmentation of nucleic acids in the sample, to what other species' genomes that may be present in the sample, to what the sample matrix may contain, to the PCR master mix being used, if multiplexing is required, to what assay controls will be, and more!  These two practiced bioinformaticians cover these challenges and then tell us how their team overcomes challenges to develop winning assays for both qPCR and dPCR applications. Our conversation uncovers the level of skill and artistry that goes into this craft. As always, you get to learn a bit more about our guests' backgrounds and career paths in the Cassie's Career Corner portion of the interview. They share how they both chose a bioinformatics path over wet lab work, while also acknowledging how important the wet lab work is to what they do. They also share some great advice and resources for anyone looking to explore a career in bioinformatics. Visit the Absolute Gene-ius page to learn more about the guests, the hosts, and the Applied Biosystems QuantStudio Absolute Q Digital PCR System. 

Vayse
VYS0037 | Elvis with a Flaming Sword - Vayse to Face with AP Strange

Vayse

Play Episode Listen Later Feb 28, 2024 113:12


VYS0037 | Elvis with a Flaming Sword - Vayse to Face with AP Strange - Show Notes In this episode Vayse welcomes AP Strange, a writer, researcher and blogger with a near encyclopaedic knowledge of all things weird and a wicked sense of humour to go with it. Hine and Buckley shake down AP's voluminous brain on a wide range of bizarre topics and greedily feast on the nuggets of information that fall out, including the answers to such questions as: What were the entities that revealed the future to AP as a child and why did he liken them to Mikey Mouse's gloves? Did AP take a ghost for a spin in his Mustang and what was revealed when he got a tarot reading from this suspected phantom? Why is a sense of humour essential to an open mind and what happens if you don't embrace that? How can we learn to receive messages from the cosmos and allow a little more Strange into our lives? How and why do people so often ignore their own experiences of High Strangeness and should more of us be open to accepting the King of Rock 'n' Roll's Flaming Sword...? (Recorded 18 February 2024) Thanks to AP for generously giving us time from his busy Sunday morning and thanks as always to Keith for his valiant and tireless work on the ever increasing show notes, give the man a follow: @peakflow.bsky.social AP Strange online Website/blog (https://www.apstrange.com/) Twitter (https://twitter.com/AProdigiosus) Instagram (https://www.instagram.com/apstrange23/) Holy Donut Revival Hour - YouTube channel (https://www.youtube.com/@DonutRevival) Holy Donut Revival Hour on Twitter (https://twitter.com/donutrevival) Holy Donut Revival Hour - Patreon (https://www.patreon.com/DonutRevival) AP's blog posts referenced in the episode My Personal Experience with the Phenomenon, Which I've told on Podcasts Too Many Times (https://www.apstrange.com/p/my-personal-experience-with-phenomenon.html) Emanations From the Clown Realm - Legend Tripping, Hilarious Magic, and Synchronicity (https://www.apstrange.com/search?q=sandown+clown) The Journey of the Fool (https://www.apstrange.com/2023/11/the-journey-of-fool.html) From Brooklyn to Neptune: The Bugs Bunny / UFO Connection! (https://www.apstrange.com/2021/02/from-brooklyn-to-neptune-bugs-bunny-ufo.html) Elvis by the Numbers or: The King and the Tower of Death (https://www.apstrange.com/2022/08/elvis-by-numbers-or-king-and-tower-of.html) The Paradox of Credibility When Confronting the Incredible (https://www.apstrange.com/2023/11/the-paradox-of-credibility-when.html) The Spooky Side of Disclosure (https://www.apstrange.com/2024/01/the-spooky-side-of-disclosure.html) Wight Magic and the Sandown Ghost Clown (https://www.apstrange.com/2023/09/wight-magic-and-sandown-ghost-clown.html) Star-cross'd Lovers (https://www.apstrange.com/2024/02/star-crossd-lovers.html) Dispatches From Jerry's Impossible Hallway (https://www.apstrange.com/2024/01/dispatches-from-jerrys-impossible.html) Hine's Intro Ultraviolet (radiation) - Wikipedia (https://en.wikipedia.org/wiki/Ultraviolet) Carbonic Acid - Wikipedia (https://en.wikipedia.org/wiki/Carbonic_acid) Dihydrogen monoxide parody - Wikipedia (https://en.wikipedia.org/wiki/Dihydrogen_monoxide_parody) Trellis (architecture) - Wikipedia (https://en.wikipedia.org/wiki/Trellis_(architecture)) Gremlins 2: Secretary - "Coffee" - YouTube (https://www.youtube.com/watchv=bk8vxL-6zpA) Paranormality magazine (https://paranormalitymag.com/) HighStrange magazine (https://high-strange.com/) SJ Brick on Twitter (https://twitter.com/Brick_Mojo) HDRH 6.0: Secrets of the Real Black Lodge Revealed with Allen Greenfield - Part One (https://www.youtube.com/watch?v=fYu3-laiYhU) HDRH 6.5: Secrets of the Real Black Lodge Revealed with Allen Greenfield! Part Two (https://www.youtube.com/watch?v=QaGkRXtRUpI) Some Other Sphere podcast (https://podcasts.apple.com/ie/podcast/some-other-sphere/id1459984683) Strange Familiars podcast (https://podcasts.apple.com/us/podcast/strangefamiliars/id1203110397) Project Archivist podcast (https://podcasts.apple.com/us/podcast/projectarchivist/id1170845611) Our Strange Skies podcast (https://podcasts.apple.com/us/podcast/our-strange-skies-ufos-throughouthistory/id1546735571) Where Did The Road Go? podcast (https://podcasts.apple.com/us/podcast/where-did-the-road-go/id597316507) AP's personal experience with the phenomenon, which he's told on podcasts too many times Mickey Mouse - Wikipedia (https://en.wikipedia.org/wiki/Mickey_Mouse) McDonald's - Wikipedia (https://en.wikipedia.org/wiki/McDonald's) My Personal Experience with the Phenomenon, Which I've told on Podcasts Too Many Times - AP Strange (https://www.apstrange.com/p/my-personal-experience-with-phenomenon.html) Monster Munch - Wikipedia (https://en.wikipedia.org/wiki/Monster_Munch) Why cartoon characters wear gloves - YouTube (https://www.youtube.com/watchv=3R3cvbLsbAk) Precognition - Wikipedia (https://en.wikipedia.org/wiki/Precognition) Out-of-body experience - Wikipedia (https://en.wikipedia.org/wiki/Out-of-body_experience) Time travel - Wikipedia (https://en.wikipedia.org/wiki/Time_travel) What Did Einstein Mean By Time is an Illusion? (https://interestingengineering.com/science/what-einstein-meant-by-time-is-an-illusion) Albert Einstein - Wikipedia (https://en.wikipedia.org/wiki/Albert_Einstein) Quantum mechanics - Wikipedia (https://en.wikipedia.org/wiki/Quantum_mechanics) The birds and the bees - Wikipedia (https://en.wikipedia.org/wiki/The_birds_and_the_bees) Eternalism (philosophy of time) - Wikipedia (https://en.wikipedia.org/wiki/Eternalism_(philosophy_of_time)) H.G. Wells - Wikipedia (https://en.wikipedia.org/wiki/H._G._Wells) The Time Machine - Wikipedia (https://en.wikipedia.org/wiki/The_Time_Machine) The Time Machine (1960 film) - Wikipedia (https://en.wikipedia.org/wiki/The_Time_Machine_(1960_film)) The Time Machine Official Trailer #1 - Rod Taylor Movie (1960) HD - YouTube (https://www.youtube.com/watch?v=36UQCZEsY9g) Rod Taylor - Wikipedia (https://en.wikipedia.org/wiki/Rod_Taylor) The Birds (film) - Wikipedia (https://en.wikipedia.org/wiki/The_Birds_(film)) The Birds (1963) Trailer - YouTube (https://www.youtube.com/watch?v=0fJh2gIBOto) Impact of Non-linear Time: A Life Perspective - All The Differences (https://allthedifferences.com/nonlinear-time-concept-lives-explored/) Psychometry (paranormal) - Wikipedia (https://en.wikipedia.org/wiki/Psychometry_(paranormal)) Time Loops: Precognition, Retrocausation, and the Unconscious by Eric Wargo - Goodreads (https://www.goodreads.com/book/show/41132463-time-loops) The Shamanic Journey - Shaman Links (https://www.shamanlinks.net/shaman-info/about-shamanism/the-shamanic-journey/) Greco-Roman mysteries (mystery schools) - Wikipedia (https://en.wikipedia.org/wiki/Greco-Roman_mysteries) The Secret Meanings of Your Cartoon Dreams: Interpreting the Symbols and Messages - Inside My Dream (https://insidemydream.com/cartoon-dream-meaning/) Cartoon physics - Wikipedia (https://en.wikipedia.org/wiki/Cartoon_physics) Top 10 Cartoon Logic That Make No Sense - YouTube (https://www.youtube.com/watch?v=oR11dPVOGsY) Surrealism - Wikipedia (https://en.wikipedia.org/wiki/Surrealism) Poltergeist - Wikipedia (https://en.wikipedia.org/wiki/Poltergeist) Toy Story - Wikipedia (https://en.wikipedia.org/wiki/Toy_Story) Toy Story (1995) Trailer #1 | Movieclips Classic Trailers - YouTube (https://www.youtube.com/watch?v=v-PjgYDrg70) Toy Story: Andy is coming up the stairs! - YouTube (https://www.youtube.com/watch?v=aPjs6ZDQrEU) Tommy Steele - I Puts the Lightie On (78rpm - 1958) - YouTube (https://www.youtube.com/watch?v=y6ufGFP1cj8) What Is The Space-Time Continuum? - IFL Science (https://www.iflscience.com/what-is-the-space-time-continuum-72244) 3D printing - Wikipedia (https://en.wikipedia.org/wiki/3D_printing) Robert Anton Wilson - Wikipedia (https://en.wikipedia.org/wiki/Robert_Anton_Wilson) Creative Agnosticism by Robert Anton Wilson - Cognitive Liberty (http://www.cognitiveliberty.org/ccle1/4jcl/4JCL61.htm) Reality Tunnel - Wikipedia (https://en.wikipedia.org/wiki/Reality_tunnel) Sam, The Sandown Ghost Clown The Isle of Wight Entity Case: AFU Special Case Report Number One - Goodreads (https://www.goodreads.com/book/show/208148989-the-isle-of-wight-entity-case) 151: Clowning Around with Stephanie Quick & AP Strange (Sam, the Sandown Clown) - Our Strange Skies podcast (https://audioboom.com/posts/8373390-151-clowning-around-with-stephanie-quick-ap-strange-sam-the-sandown-clown) Bufora Journal Vol 6, No 5, Jan/Feb 1978 - Bufora.org (https://bufora.org.uk/documents/BUFORAJournalVolume6No.5JanFeb1978.pdf) Note: The article which contains the Sandown Clown report starts on page 9. Sam The Sandown Ghost Clown - The Cryptonaut Podcast (https://podcasts.apple.com/us/podcast/sam-the-sandown-ghost-clown/id1331837883?i=1000423668154) Sam the Sandown Ghost Clown (England) - Cryptopia (https://www.cryptopia.us/site/2018/11/sam-the-sandown-ghost-clown-england/) The Sandown “Ghost Clown,” 1973 - YouTube (https://www.youtube.com/watch?v=MBdfBTXWtFo) Warminster - Wikipedia (https://en.wikipedia.org/wiki/Warminster) Wiltshire - Wikipedia (https://en.wikipedia.org/wiki/Wiltshire) Emanations From the Clown Realm - Legend Tripping, Hilarious Magic, and Synchronicity - AP Strange blog post (https://www.apstrange.com/search?q=sandown+clown) Childhood hallucinations are surprisingly common – but why? - The Guardian (https://www.theguardian.com/science/2015/jun/07/childhood-hallucinations-common-research-psychotic-schizophrenia-why) Brain scans show how LSD mimics mind of a baby - Reuters (https://www.reuters.com/article/idUSKCN0X82AK/) Theta waves in children's waking electroencephalogram resemble local aspects of sleep during wakefulness - NCBI (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5593855/) What do psychedelics, meditation, and babies have in common? - Jeff Valdivia on Medium (https://jeff-valdivia.medium.com/what-do-psychedelics-meditation-and-babies-have-in-common-5f75690ef0d9) What is high strangeness? High Strangeness And Understanding It - Global Bizarre (https://globalbizarre.com/high-strangeness/) Psychosocial UFO hypothesis - Wikipedia (https://en.wikipedia.org/wiki/Psychosocial_UFO_hypothesis) The Clown/MiB Connection by Fred Andersson - Medium (https://fred-andersson.medium.com/the-clown-mib-connection-180c97617b8f) Hypnotic induction - Wikipedia (https://en.wikipedia.org/wiki/Hypnotic_induction) Derren Brown - Snapping Induction - YouTube (https://www.youtube.com/watch?v=ka22sDSniKg) Jacques Vallée - Wikipedia (https://en.wikipedia.org/wiki/Jacques_Vall%C3%A9e) Men in black - Wikipedia (https://en.wikipedia.org/wiki/Men_in_black) John Keel - Wikipedia (https://en.wikipedia.org/wiki/John_Keel) Is Consciousness Part of the Fabric of the Universe? - Scientific American (https://www.scientificamerican.com/article/is-consciousness-part-of-the-fabric-of-the-universe1/) As above, so below - Wikipedia (https://en.wikipedia.org/wiki/As_above,_so_below) Quantum entanglement - Wikipedia (https://en.wikipedia.org/wiki/Quantum_entanglement) Time travel - Wikipedia (https://en.wikipedia.org/wiki/Time_travel) Jacques Vallée, Ph.D. on the UFO Phenomenon being a Genuine Scientific Problem - YouTube (https://www.youtube.com/watch?v=vWsWpa1Lfl4) - Presentation by JV. Includes an analysis of the correlation between degrees of strangeness and reported/unreported cases Synchronicity - Wikipedia (https://en.wikipedia.org/wiki/Synchronicity) Mick West - Wikipedia (https://en.wikipedia.org/wiki/Mick_West) Jaime Maussan - Wikipedia (https://en.wikipedia.org/wiki/Jaime_Maussan) Liminality, anti-structure, and reckless wizards VYS0036 | Infinite Game - Vayse to Face with Joseph Matheny (https://www.vayse.co.uk/vys0036) Alternate reality game (ARG) - Wikipedia (https://en.wikipedia.org/wiki/Alternate_reality_game) Consensus reality - Wikipedia (https://en.wikipedia.org/wiki/Consensus_reality) The Trickster and the Paranormal by George P Hansen - Goodreads (https://www.goodreads.com/book/show/669028.The_Trickster_and_the_Paranormal) Liminality - Wikipedia (https://en.wikipedia.org/wiki/Liminality) Structure vs. Communitas/Antistructure: Victor Turner on the two modes of human society - Living Philosophy (https://www.thelivingphilosophy.com/structure-vs-communitas-antistructure/) Shamanism - Wikipedia (https://en.wikipedia.org/wiki/Shamanism) Hermetic Qabalah - Wikipedia (https://en.wikipedia.org/wiki/Hermetic_Qabalah) Hermetic Order of the Golden Dawn - Wikipedia (https://en.wikipedia.org/wiki/Hermetic_Order_of_the_Golden_Dawn) The Meaning of Magic - Psychology Today (https://www.psychologytoday.com/us/blog/hide-and-seek/202008/the-meaning-magic) Israel Regardie - Wikipedia (https://en.wikipedia.org/wiki/Israel_Regardie) The Middle Pillar: The Balance Between Mind and Magic by Israel Regardie - Goodreads (https://www.goodreads.com/book/show/377494.The_Middle_Pillar) Shamans among us, and the disappearing tarot reader Shamans as Healers, Counsellors, and Psychotherapists - Research Gate (https://www.researchgate.net/publication/286007361_Shamans_as_Healers_Counselors_and_Psychotherapists) Exploring Modern Shamanism: Practices, Challenges, and Benefits in Today's World - Go Ask Uncle (https://goaskuncle.com/exploring-modern-shamanism-practices-challenges-and-benefits-in-todays-world/) Tarot - Wikipedia (https://en.wikipedia.org/wiki/Tarot) Cataract - Wikipedia (https://en.wikipedia.org/wiki/Cataract) Ford Mustang - Wikipedia (https://en.wikipedia.org/wiki/Ford_Mustang) Psychic - Wikipedia (https://en.wikipedia.org/wiki/Psychic) Crystal ball - Wikipedia (https://en.wikipedia.org/wiki/Crystal_ball) The Size Of Sports Balls Compared - Measuring Stuff (https://measuringstuff.com/the-size-of-sports-balls-compared/) Cherry - Wikipedia (https://en.wikipedia.org/wiki/Cherry) Rubber up - Word Sense (https://www.wordsense.eu/rubber_up/) Hair bleaching - Wikipedia (https://en.wikipedia.org/wiki/Hair_bleaching) Parallel universes, alternative lives, and the simulation hypothesis In a Parallel Universe, Another You - New York Times (https://www.nytimes.com/2022/06/20/special-series/michio-kaku-multiverse-reality.html) The Shamanic Journey - Shaman Links (https://www.shamanlinks.net/shaman-info/about-shamanism/the-shamanic-journey/) Spirit guide - Wikipedia (https://en.wikipedia.org/wiki/Spirit_guide) Anthony Peake's website (https://www.anthonypeake.com/) Is There Life After Death? The Extraordinary Science of What Happens When We Die by Anthony Peake - Goodreads (https://www.goodreads.com/book/show/1261585.Is_There_Life_After_Death_The_Extraordinary_Science_of_What_Happens_When_We_Die) Cheating the Ferryman: The Revolutionary Science of Life After Death by Anthony Peake - Goodreads (https://www.goodreads.com/book/show/59743798-cheating-the-ferryman) Simulation hypothesis - Wikipedia (https://en.wikipedia.org/wiki/Simulation_hypothesis) The Simulation Hypothesis by Rizwan Virk - Goodreads (https://www.goodreads.com/book/show/44141381-the-simulation-hypothesis) Potato chip - Wikipedia (https://en.wikipedia.org/wiki/Potato_chip) Clockwork universe - Wikipedia (https://en.wikipedia.org/wiki/Clockwork_universe) Vedanta - Wikipedia (https://en.wikipedia.org/wiki/Vedanta) Hinduism - Wikipedia (https://en.wikipedia.org/wiki/Hinduism) Buddhism - Wikipedia (https://en.wikipedia.org/wiki/Buddhism) Dharmachakra - Wikipedia (https://en.wikipedia.org/wiki/Dharmachakra) Bhavacakra (Wheel of Life) - Wikipedia (https://en.wikipedia.org/wiki/Bhavacakra) Maya (religion) - Wikipedia (https://en.wikipedia.org/wiki/Maya_(religion)) Quantum physics - New Scientist (https://www.newscientist.com/definition/quantum-physics/) Holodeck (Star Trek) - Wikipedia (https://en.wikipedia.org/wiki/Holodeck) The Matrix - Wikipedia (https://en.wikipedia.org/wiki/The_Matrix) Allegory of the cave (Plato) - Wikipedia (https://en.wikipedia.org/wiki/Allegory_of_the_cave) Sutra - Wikipedia (https://en.wikipedia.org/wiki/Sutra) Hindu saints - Wikipedia (https://en.wikipedia.org/wiki/Hindu_saints) Bit - Wikipedia (https://en.wikipedia.org/wiki/Bit) Binary code - Wikipedia (https://en.wikipedia.org/wiki/Binary_code) Quantum computing - Wikipedia (https://en.wikipedia.org/wiki/Quantum_computing) Christopher Walken - Wikipedia (https://en.wikipedia.org/wiki/Christopher_Walken) VYS0034 | The Weird Review of the Year 2023 Pt.1 (https://www.vayse.co.uk/vys0034) The Weird Review of the Year 2023 Pt.2 (https://www.vayse.co.uk/vys0035) Video-game - Wikipedia (https://en.wikipedia.org/wiki/Video_game) Wave function - Wikipedia (https://en.wikipedia.org/wiki/Wave_function) Quantum non-locality - Wikipedia (https://en.wikipedia.org/wiki/Quantum_nonlocality) Selective rendering: Computing only what you see - Research Gate (https://www.researchgate.net/publication/220979059_Selective_rendering_Computing_only_what_you_see) Messages from the Cosmos Western esotericism - Wikipedia (https://en.wikipedia.org/wiki/Western_esotericism) Mysticism - Wikipedia (https://en.wikipedia.org/wiki/Mysticism) Koan - Wikipedia (https://en.wikipedia.org/wiki/Koan) Ram Dass - Wikipedia (https://en.wikipedia.org/wiki/Ram_Dass) Be Here Now (book) - Wikipedia (https://en.wikipedia.org/wiki/Be_Here_Now_(book)) Be Here Now by Ram Dass - Goodreads (https://www.goodreads.com/book/show/41580312-be-here-now) Ram Dass Quote on Moving Forward and How Your Next Message Is Always Right Where You Are - Move Me Quotes (https://movemequotes.com/sunbeams-7/) Active Meditation: How to Meditate While You Move - PsychCentral (https://psychcentral.com/health/active-meditation) Animism - Wikipedia (https://en.wikipedia.org/wiki/Animism) Cultivating a Practice of Sacred Nature Connection - Wild Rhythms (https://wild-rhythms.com/blog/2020/10/18/cultivating-a-practice-of-sacred-nature-connection/) Playing card - Wikipedia (https://en.wikipedia.org/wiki/Playing_card) Fortune cookie - Wikipedia (https://en.wikipedia.org/wiki/Fortune_cookie) Synchronicity - Wikipedia (https://en.wikipedia.org/wiki/Synchronicity) George Washington - Wikipedia (https://en.wikipedia.org/wiki/George_Washington) The George Washington connection to the north Lancashire village of Warton - Great British Life (https://www.greatbritishlife.co.uk/homes-and-gardens/places-to-live/22624334.george-washington-connection-north-lancashire-village-warton/) Scrabble - Wikipedia (https://en.wikipedia.org/wiki/Scrabble) Tarot - Wikipedia (https://en.wikipedia.org/wiki/Tarot) The Fool (Tarot card) - Wikipedia (https://en.wikipedia.org/wiki/The_Fool_(tarot_card)) The Journey of the Fool - AP Strange (https://www.apstrange.com/2023/11/the-journey-of-fool.html) Lateral thinking - Wikipedia (https://en.wikipedia.org/wiki/Lateral_thinking) Dream logic helps us understand the workings of the brain and mind - Psychology Today (https://www.psychologytoday.com/us/blog/sleepless-in-america/202009/dream-logic) Intuition - Wikipedia (https://en.wikipedia.org/wiki/Intuition) Allen Greenfield on Twitter (https://twitter.com/allengreenfield) Illuminism - Encyclopedia.com (https://www.encyclopedia.com/religion/encyclopedias-almanacs-transcripts-and-maps/illuminism) Gnosis - Wikipedia (https://en.wikipedia.org/wiki/Gnosis) Talk Gnosis - Free Illuminism, Memphis Misraim, & Hidden Realms w/Dr. Allen Greenfield - YouTube (https://www.youtube.com/watch?v=-3d81_QKkUk) Empty Your Cup: Why Unlearning Is Vital for Success - Psychology Today (https://www.psychologytoday.com/us/blog/the-adaptive-mind/202307/empty-your-cup-why-unlearning-is-vital-for-success) Stephanie Quick's blog (https://stephaniequick.home.blog/) Humour in occultism, forgetting weird experiences, and generating synchronicities From Brooklyn to Neptune: The Bugs Bunny / UFO Connection! - AP Strange (https://www.apstrange.com/2021/02/from-brooklyn-to-neptune-bugs-bunny-ufo.html) Elvis by the Numbers or: The King and the Tower of Death - AP Strange (https://www.apstrange.com/2022/08/elvis-by-numbers-or-king-and-tower-of.html) Flaming sword (mythology) - Wikipedia (https://en.wikipedia.org/wiki/Flaming_sword_(mythology)) Aleister Crowley - Wikipedia (https://en.wikipedia.org/wiki/Aleister_Crowley) Guardian angel: Thelema - Wikipedia (https://en.wikipedia.org/wiki/Guardian_angel#Thelema) List of demons in the Ars Goetia - Wikipedia (https://en.wikipedia.org/wiki/List_of_demons_in_the_Ars_Goetia) Lesser ritual of the pentagram - Wikipedia (https://en.wikipedia.org/wiki/Lesser_ritual_of_the_pentagram) Dungeons & Dragons (D&D) - Wikipedia (https://en.wikipedia.org/wiki/Dungeons_%26_Dragons) Heavy Metal (magazine) - Wikipedia (https://en.wikipedia.org/wiki/Heavy_Metal_(magazine)) Horror film - Wikipedia (https://en.wikipedia.org/wiki/Horror_film) Shared Hallucinations & Parallel Universes: Joint Adventures in Holographic Dreamscapes - Official Brendan Murphy (https://officialbrendanmurphy.substack.com/p/shared-hallucinations-and-parallel) Poltergeist - Wikipedia (https://en.wikipedia.org/wiki/Poltergeist) The Neuroscience of How We Intentionally Forget Experiences - Psychology Today (https://www.psychologytoday.com/us/blog/the-athletes-way/201605/the-neuroscience-how-we-intentionally-forget-experiences) Dishwasher - Wikipedia (https://en.wikipedia.org/wiki/Dishwasher) Fruitcake - Wikipedia (https://en.wikipedia.org/wiki/Fruitcake) How To Induce Synchronicities - Ghost Dog is a Mystery Box (Steph Quick) (https://stephaniequick.home.blog/2019/01/23/how-to-induce-synchronicities/) Coincidence - Wikipedia (https://en.wikipedia.org/wiki/Coincidence) AP's spiritual beliefs Ontology - Wikipedia (https://en.wikipedia.org/wiki/Ontology) Discordianism - Wikipedia (https://en.wikipedia.org/wiki/Discordianism) Buddhism - Wikipedia (https://en.wikipedia.org/wiki/Buddhism) Taoism (Daoism) - Wikipedia (https://en.wikipedia.org/wiki/Taoism) Vedas - Wikipedia (https://en.wikipedia.org/wiki/Vedas) Hinduism - Wikipedia (https://en.wikipedia.org/wiki/Hinduism) Transcendental Meditation - Wikipedia (https://en.wikipedia.org/wiki/Transcendental_Meditation) Witchcraft - Wikipedia (https://en.wikipedia.org/wiki/Witchcraft) Hermetism and other religions: Christianity - Wikipedia (https://en.wikipedia.org/wiki/Hermetism_and_other_religions#Christianity) Western esotericism - Wikipedia (https://en.wikipedia.org/wiki/Western_esotericism) Mysticism - Wikipedia (https://en.wikipedia.org/wiki/Mysticism) The Communion of Saints - Simply Catholic (https://www.simplycatholic.com/the-communion-of-saints/) The Practice of Contemplative Prayer - Catholic Exchange (https://catholicexchange.com/practice-contemplative-prayer/) An Introduction to the Basic Beliefs of the Vodou (Voodoo) Religion (https://www.learnreligions.com/vodou-an-introduction-for-beginners-95712) Dyson Sphere - Wikipedia (https://en.wikipedia.org/wiki/Dyson_sphere) AP's take on the whole disclosure thing David Grusch UFO whistleblower claims - Wikipedia (https://en.wikipedia.org/wiki/David_Grusch_UFO_whistleblower_claims) Extraterrestrial UFO hypothesis - Wikipedia (https://en.wikipedia.org/wiki/Extraterrestrial_UFO_hypothesis) Astrophysics - Wikipedia (https://en.wikipedia.org/wiki/Astrophysics) Jellyfish UAP Megathread - Reddit (https://www.reddit.com/r/UFOs/comments/193gzll/jellyfish_uap_megathread/) Jeremy Corbell - Wikipedia (https://en.wikipedia.org/wiki/Jeremy_Corbell) The Paradox of Credibility When Confronting the Incredible - AP Strange (https://www.apstrange.com/2023/11/the-paradox-of-credibility-when.html) The Spooky Side of Disclosure - AP Strange (https://www.apstrange.com/2024/01/the-spooky-side-of-disclosure.html) Perception management - Wikipedia (https://en.wikipedia.org/wiki/Perception_management) What are UAPs, and why do UFOs have a new name? - CBS News (https://www.cbsnews.com/news/what-are-uaps-unexplained-aerial-phenomenon-ufos-new-name/) Non-Human Intelligence (NHI) - Unidentified Phenomena (https://unidentifiedphenomena.com/topics/non-human-intelligence-nhi/) Diana Walsh Pasulka - Wikipedia (https://en.wikipedia.org/wiki/Diana_Walsh_Pasulka) History of espionage - Wikipedia (https://en.wikipedia.org/wiki/History_of_espionage) Secret society - Wikipedia (https://en.wikipedia.org/wiki/Secret_society) UFO Sightings by Country 2024 - World Population Review (https://worldpopulationreview.com/country-rankings/ufo-sightings-by-country) The new American religion of UFOs (includes conversation with Diana Pasulka) - Vox (https://www.vox.com/culture/2019/6/4/18632778/ufo-aliens-american-cosmic-diana-pasulka) Cybernetics - Wikipedia (https://en.wikipedia.org/wiki/Cybernetics) Ronald Mcdonald - Wikipedia (https://en.wikipedia.org/wiki/Ronald_McDonald) Philip K. Dick - Wikipedia (https://en.wikipedia.org/wiki/Philip_K._Dick) Weird Studies Episode 20: The Trash Stratum - Part 1 (https://www.weirdstudies.com/20) Weird Studies Episode 21: The Trash Stratum - Part 2 (https://www.weirdstudies.com/21) Marginalia - Wikipedia (https://en.wikipedia.org/wiki/Marginalia) The X-Files – "The truth is out there" - ACMI (https://www.acmi.net.au/stories-and-ideas/the-x-files-the-truth-is-out-there/) Maybe The Real Treasure Was the Friends We Made Along the Way - Know Your Meme (https://knowyourmeme.com/memes/maybe-the-real-treasure-was-the-friends-we-made-along-the-way) Return of the Sandown Ghost Clown Wight Magic and the Sandown Ghost Clown - AP Strange (https://www.apstrange.com/2023/09/wight-magic-and-sandown-ghost-clown.html) The Ghosts of Gettysburg: A Haunted History of a Battlefield - War History Online (https://www.warhistoryonline.com/instant-articles/battle-of-gettysburg-the-haunted.html) Isle of Wight Festival 1970 - Wikipedia (https://en.wikipedia.org/wiki/Isle_of_Wight_Festival_1970) Hawkwind - Wikipedia (https://en.wikipedia.org/wiki/Hawkwind) Pink Floyd - Wikipedia (https://en.wikipedia.org/wiki/Pink_Floyd) Black Widow (band) - Wikipedia (https://en.wikipedia.org/wiki/Black_Widow_(band)) Black Widow - Come To The Sabbat (1972) - YouTube (https://www.youtube.com/watch?v=zDk4UtCOQ5E) In 1926, Houdini Spent 4 Days Shaming Congress for Being in Thrall to Fortune-Tellers - Atlas Obscura (https://www.atlasobscura.com/articles/in-1926-houdini-spent-4-days-shaming-congress-for-being-in-thrall-to-fortunetellers) Finding weirdness in the mundane Star-cross'd Lovers - AP Strange (https://www.apstrange.com/2024/02/star-crossd-lovers.html) Dispatches From Jerry's Impossible Hallway - AP Strange (https://www.apstrange.com/2024/01/dispatches-from-jerrys-impossible.html) Frasier (tv sitcom) - Wikipedia (https://en.wikipedia.org/wiki/Frasier) When Even the Simplest Word Looks Weird And Wrong You Have Wordnesia - Smithsonian Magazine (https://www.smithsonianmag.com/smart-news/when-even-simplest-word-looks-weird-and-wrong-you-have-wordnesia-180954539/) Semantic satiation - Wikipedia (https://en.wikipedia.org/wiki/Semantic_satiation) Aphorism - Wikipedia (https://en.wikipedia.org/wiki/Aphorism) House of Frankenstein (film, 1944) - Wikipedia (https://en.wikipedia.org/wiki/House_of_Frankenstein_(film)) House of Frankenstein (1944) Official Trailer #1 - YouTube (https://www.youtube.com/watch?v=I90bPakb1zs) Igor (character) - Wikipedia (https://en.wikipedia.org/wiki/Igor_(character)) Bela Lugosi - Wikipedia (https://en.wikipedia.org/wiki/Bela_Lugosi) The Hunchback Of Notre-Dame (novel) - Wikipedia (https://en.wikipedia.org/wiki/The_Hunchback_of_Notre-Dame) Quasimodo - Wikipedia (https://en.wikipedia.org/wiki/Quasimodo) AP's recommendations The Mixed-Up Masters of Early Animation - The New Yorker (https://www.newyorker.com/magazine/2020/12/28/the-mixed-up-masters-of-early-animation) Surrealism - Wikipedia (https://en.wikipedia.org/wiki/Surrealism) Un Chien Andalou - Wikipedia (https://en.wikipedia.org/wiki/Un_Chien_Andalou) TRIGGER WARNING - Un Chien Andalou - Full Movie - YouTube (https://www.youtube.com/watch?v=JbBfHy2qNeA) Salvador Dalí - Wikipedia (https://en.wikipedia.org/wiki/Salvador_Dal%C3%AD) Luis Buñuel - Wikipedia (https://en.wikipedia.org/wiki/Luis_Bu%C3%B1uel) Epic poetry - Wikipedia (https://en.wikipedia.org/wiki/Epic_poetry) Victorian literature - Wikipedia (https://en.wikipedia.org/wiki/Victorian_literature) Pulp magazine - Wikipedia (https://en.wikipedia.org/wiki/Pulp_magazine) Marvel Cinematic Universe - Wikipedia (https://en.wikipedia.org/wiki/Marvel_Cinematic_Universe) Iron Maiden (band) - Wikipedia (https://en.wikipedia.org/wiki/Iron_Maiden) Buckley's closing story Hartlepool - Wikipedia (https://en.wikipedia.org/wiki/Hartlepool) Hartlepool: Monkeys - Wikipedia (https://en.wikipedia.org/wiki/Hartlepool#Monkeys) Monkey hanger - Wikipedia (https://en.wikipedia.org/wiki/Monkey_hanger) The Man-Monkey of Shropshire Union Canal - Spooky Isles (https://www.spookyisles.com/man-monkey-shropshire-union-canal/) The Pond Square Chicken, Highgate - Mysterious Britain (https://www.mysteriousbritain.co.uk/hauntings/pond-square-chicken-highgate/) The Bizarre, True Story of Gef the Talking Mongoose - Atlas Obscura (https://www.atlasobscura.com/articles/gef-the-talking-mongoose-true-story-nandor-fodor) Francis Bacon - Wikipedia (https://en.wikipedia.org/wiki/Francis_Bacon) Salmonella - Wikipedia (https://en.wikipedia.org/wiki/Salmonella) Vayse Online Vayse website (https://www.vayse.co.uk/) Vayse on Twitter (https://twitter.com/vayseesyav) Vayse on Instagram (https://www.instagram.com/vayseesyav/) Music From Vayse: Volume 1 by Polypores - Bandcamp (https://vayse.bandcamp.com/album/music-from-vayse-volume-1) Vayse on Ko-Fi (https://ko-fi.com/vayse) Vayse email: vayseinfo@gmail.com Special Guest: AP Strange.

Wellness Force Radio
AMA: The Wisdom of Cold Hot Therapy, Why Men Don't Do Inner Work, Fertility Fallacies + Drinking Green Juice

Wellness Force Radio

Play Episode Listen Later Feb 2, 2024 21:34


Wellness + Wisdom Episode 609 Wellness + Wisdom Podcast Host and Wellness Force Media CEO, Josh Trent, answers questions from our audience about men's inner work, the benefits of hot and cold therapy, and the benefits of drinking green juice! Live Life Well from Sunrise to Sunset Save 20% with code "WELLNESSFORCE" on everyone's favorite Superfoods brand, ORGANIFI, including their Sunrise to Sunset Bundle and their Women's Power Stack that includes HARMONY + GLOW for true hormonal balance and great health radiating through your beautiful skin. Click HERE to order your Organifi today. Are You Stressed Out Lately? Take a deep breath with the M21™ wellness guide: a simple yet powerful 21 minute morning system that melts stress and gives you more energy through 6 science-backed practices and breathwork. Click HERE to download for free. Biohack Your Mind & Body with Plunge Ice Baths!Save $150 on your PLUNGE order with code "WELLNESSFORCE" As seen on Shark Tank, Plunge's revolutionary Cold Plunge uses powerful cooling, filtration, and sanitation to give you cold, clean water whenever you want it, making it far superior to an ice bath or chest freezer. *Review The Wellness + Wisdom Podcast & WIN $150 in wellness prizes! *Join The Facebook Group Today's Questions: @lindsay_dotscott: Which would you do first? Cryo or sauna? Which order should we do them in and why? @drkevinpreston: Why do you think the masculine has been avoiding the inner work, emotions, and taking ownership at a new level, as well as avoiding their own deeply intuitive aspects? Obviously, a broad generalization as there are so many that are doing the work. @picturolande: I am 38 and struggling with fertility. Do you have any podcasts on that or supplements to recommend? @jeffturnerra: What to do when a loved one thinks your health advice is crazy... When they won't drink the green juice and instead just want the doctor's pills? BREATHE: Breath & Wellness Program Get 33% off of the BREATHE: Breath & Wellness Program with the code PODCAST33   Boost your immunity and calm your mind with freedom from chronic stress in the modern world. A 21 day guided breath and wellness program using ancient wisdom to boost your immunity, calm your mind, and give you freedom from chronic stress in the modern world. Combining special breathwork infused with safe vape cannabidiol, BREATHE gives you everything you need to let go of old weight, de-stress, and build immunity so you can live your best life. In this special (limited time) offer, you will receive: - Lifetime access to BREATHE - Free upgrades to all future training modules - Free additional training modules - Special VIP coupons for safe vape, essential oils, CBD, nootropics and more - Private WF group access Listen To Episode 609 as Josh Trent Responds to Your Questions! [00:00] Introduction Hey, what's up? It's Josh Trent. This is Wellness + Wisdom, the place where as always, you can nourish all five sides of your wellness, Pentagon, the physical, mental, emotional, spiritual, and financial wellness, the ways that we all signed up to master here on planet earth as humans. Today's special AMA - ask me anything. This may or may not be the perfect place for you to start. If you're looking for a full-length guest episode, check out our Tuesday shows where I go deep with a world-class person who is at the leading edge of their field in all these five sides of the Wellness Pentagon. I've been loving the episodes we came out with lately with Ashleigh di Lello and Akshay Nanavati. They have been so profound for so many people. If you ever want to give us feedback, you can do so at admin@wellnessforce.com. In this AMA, we're talking about the wisdom of cold hot therapy, why men don't do inner work, fertility fallacies, and drinking green juice. Cool topics. These are really interesting. It's an amazing opportunity on these AMAs this year for us to get to know each other on a deeper level, and we're doing a lot of these AMAs this year. Will you actually get to record your voice on a recorder and ask us a 90-second or less question? And also just give us any feedback. Do you love the pod? Do you hate the pod? Do you not care about the pod? Can you not go without the pod? Well, I guess you're here, so this is going to be a great question for you to answer for us. And also just to ask us a question 90 seconds or less, if we select your question, we'll put it into the actual podcast so your voice will broadcast out to tens of thousands of people across the world, which I think is pretty cool. That's why I do what I do. So if you're interested in that, head over to JoshTrent.com/AMA. Submit your questions, 90 seconds or less, and if we select it, we'll put it in the actual podcast, which I think is pretty freaking amazing. [01:45] The Best Deals on Wellness Products And by the way, this podcast is brought to you for free every single week. I will never charge for this show because you deserve a place wherever you are on the financial scale that has inspiring episodes, inspiring content, inspiring people, inspiring wisdom, and wellness every single week from my heart to yours. All that I ask is that you go to JoshTrent.com/Store and buy some of the products that you're buying anyways, but you just get them at 40% or more discounted in comparison to Amazon or the interweb. Seriously, I'm not even joking. A lot of these products are much, much, much cheaper than Amazon. I've negotiated. I've cut out the middleman for some amazing deals. So whether it's skincare, hydration, energy, nootropics, supplementation of any kind, digestion, gut health, or anything and everything from teeth to toe, from top to bottom for your wellness, you can find it at JoshTrent.com/Store. So support the show and support your wallet and also support your wellness. [03:25] Hot + Cold Therapy Alright, let's get into this. Our first question is from @lindsay_dotscott: "Which would you do first, cryo or sauna? Which order should we do them and why?" This is my favorite thing to do. I actually just had a guest come over to the house today and this morning we did hot therapy followed by cold therapy, and that is the way you want to do it, not just because of the science, because it feels better. Here's the science though. Infrared heat provokes heat shock proteins, vasodilation and detoxification, cryotherapy. Then vasoconstricts the tissue in blood vessels. This facilitates a reduction in inflammation and pain. It's important. By the way, do not do cold plunges right after strength training. This is kind of a caveat. You'll lose your gains created by the tearing that creates lactic acid by the actin myosin and the muscle fiber and the sarcomere. This is the thing that actually makes your muscles sore the next day, and that's what makes your muscles dense and grow. So going back to what I talked about, the contrast between muscle relaxation and increased blood flow to cold exposure, increased breathing, and other cold plunge triggers, stimulate mental toughness. This is kind of a tertiary benefit, maybe even a primary benefit to doing cold therapy. You can train yourself to be better in the moment when your spouse is yelling at you or your husband is pissing you off and you're like, how could you? Imagine if you weren't as triggered by that by doing the cold plunge, followed by the hot. You're getting a lot of different things. You're getting emotional training, you're getting physical training, you're also getting some soul training. Here's why right before you go into the cold plunge, especially like I did this morning. 41 degrees when it's 30 degrees outside, it's actually a little bit warmer in the tub, which is kind of cool. You get really hot, you do 10, 15, 20 minutes. I did a 45-minute session at 145 or 150 degrees with a friend so you can have some bonding time that's even more fun. And then what Alex and I did, we went into the cold plunge right after that, so we got that vasodilation from the heat shock proteins, and then we got that vasoconstriction. In other words, all the blood is shunting to the internal organs. What's going on when you do hot cold? Here's the real skinny on why you want to do this. When you do the hot therapy, you're getting increased blood flow, you're getting increased respiration, you're getting that detox that I talked about, but the most important thing is you're getting all this blood going to the skin, the epidermis, the largest organ on your whole system, your whole body, and that's what's actually detoxifying you, right? The heat is being pushed away from your organs so that they don't boil or melt, and that's actually where the sweat comes from. The sweat is coming from the water in your organs and the water in your body pushing it out because it's freaking hot. That's the heat shock proteins, right? That's the vasodilation. Then you get vasoconstriction right away, boom. You go into the cold, all the blood goes right back. It goes right back to your internal organs. When it's in your internal organs, it's getting all those little nooks and crannies and all the different pieces of the sarcomere and all the striations and the little knots. It's actually pushing blood through those and it's opening up tissues. It's constricting. It's shunting the blood to your internal organs. This is the health benefit of the hot and cold, the back and forth. This is why it's so badass. And Lindsay, thank you for your question. Always do the sauna first, then the cryo or the cold. [06:45] Are Men Not Willing to Do The Inner Work? Next question. This is from Dr. Kevin Preston. We had an organic video go almost 2 million views on Instagram. Maybe by the time you're hearing this, it's 2 million views, which I think is pretty cool. That is pretty amazing that 2 million people have heard the clip with Dr. Kevin and me. Kevin says: "Why do you think the masculine has been avoiding the inner work emotions and taking ownership at a new level as well as avoiding their own deeply intuitive aspects?" Obviously, a broad generalization as there are so many things and so many men that are so many men that are doing the work. Yeah, it is a broad generalization, but here's what I'd like to say. A lot of generalizations can be true when you look at a lens of modernity. Modernity is somebody who is caught up with credit card payments, bills, all the things that kind of weigh us down and make us focused on stress and torment and toil, working long hours and just being really in the mind, not being in the body. This is my question for me, and this is the answer for Kevin. How can we as men do the inner work by actually spending more time in our bodies, our subtle emotional body, our real essence of being in our heart chakra, our throat chakra, and actually just being physically in our body? Here's what I mean by this, and this is my answer, Dr. Kevin. I think what's going on for so long is men have been judged by the zeros at the end of their bank account and men have been judged by only what they can provide. And so we as men have a lot of conditioning to unravel starting at the heart. Our heart is worthy, our heart is loving, our heart is powerful, and not the only measure of a man's power is judged by the zeroes on his bank account. That's first and foremost. I think that's why the masculine has been avoiding doing the inner work because we have been so focused and we have been so trained by fucking society to just be a provider and to make sure that we have the Lamborghini, the big house, the white picket fence, the boat, the toys, and all the bullshit that I heard once buying things that you don't need to impress people that you don't even like. I think that is why the masculine has been avoiding doing the inner work and taking ownership at a new level. And this is the question and answer that I go back and forth with, and this is for myself, Dr. Kevin, and for all the ladies and all the men out there, the broad generalization that so many are doing the work and not doing the work, I think it really comes down to the lens of modernity. I really believe this. The question is how do we thrive as half beast and half spirit in modernity? How do we honor the beast in us, the physical breath work, strength training, hot cold therapy, going for walks, making sweet love to your partner, your lady, your man, spending time breathing breathwork, which you can find at breathwork.io. It's my absolute favorite program. It's not just because it's mine, it's because I distilled all the wisdom from all the kinds of woo-woo stuff out there. Let's be honest. There's a lot of woo capital, w woo kind of bullshit out there when it comes to breathwork. And so I wanted to create something practical for people, and I also went through the journey myself after actually eight years now, almost eight years of going deep and getting trained by breathwork facilitators across the world, literally. I mean like Hawaii, Thailand, Arizona, and California. I went across the world and I was like, what is everybody doing in this breathwork that actually moves the needle that brings us back home to homeostasis? This is what I think men need, Dr. Kevin, and for all of us. If the masculine has been avoiding doing the inner work and taking emotional inventory, taking ownership at a new level, and we and I, we all have to be willing to actually take a breath, be in our body, feel the throat, feel the heart, feel the stomach, feel our cock. I don't mean to offend anyone but feel our fucking cock. That's what we need to do. We need to feel our cock again as men, not through porn, not through screens, not through Instagram, looking at girls' asses that they're putting out there. I mean, really feel the sacredness in our chakras, in our throat, in our perineum, in our cock, in our stomach. This is what we need on a new level. If we want to be at a new level, then we have to go to an old way. We have to actually physically be in our body much like our ancestors were for so long. I think that's the answer. I think avoidance is actually just a coping strategy to modernity. So really the balance, and this is what we explore so much on the podcast, and if you love this, then go over to JoshTrent.com/Podcast, subscribe, and tap the button wherever you're listening to this. This is what we're going into so much this year with the Liberated Life Community, the community that you can go and sign up for right now, and you can be part of the waitlist to join the community when it goes live in late March, early April, JoshTrent.com/Liberation, and in this community and all of our content, this is what we're exploring, right? If the masculine and the feminine inside of both men and women, by the way, are being called to a new level, being called to take ownership of our lives at a new level as well as leaning into our shit, leaning into our pain, there's no way that we're going to be able to be the old version of us in the new world, the new modernity. So this is a big sweeping shout for all of us to rise not from shame or blame, not from being not good enough, but from actually forgetting that we are so powerful and we have forgotten this. So let's remember how powerful we are. Not in a woo-woo kind of way, but the only way we can remember how powerful we are is if we actually spend time with us in our bodies, in our physical selves. This is breathwork.io. This is the 21-day program that I've created, and this is the kind of ownership that can happen when you start really actually breathing and being in your body. You can use the code "PODCAST33". I've been giving 33% off to our podcast listeners. It's already cheaper, by the way than going out and having some dinner with your friends. Definitely if you're drinking, cut out some drinks for a weekend and learn breathwork instead. That's going to be much richer and much more rewarding for your system anyway, so it's a multifaceted question, Dr. Kevin. It's a great question. I look forward to having another podcast where we go deep into that, but let's move on in the interest of time. [12:58] Fertility Supplements This is from @picturolande: "I'm 38 and I'm struggling with fertility. Do you have any podcasts on that or supplements to recommend?" Yes, straight up. I just took it before I recorded this podcast, JoshTrent.com/MANNA. Now look at Shilajit specifically, there is a ton of NCBI and PubMed research on the virility of MANNA and the way that Shilajit affects the libido and testosterone. cIt's a natural libido and testosterone enhancer. It's concentrated plant matter y'all that's been marinating at 10,000 feet plus in the Himalayas. Nature has some wisdom there. Anytime the sun cooks plants down to their raw essence and then you eat those plants, specifically our allies like the Sheila Jet, this is going to make you dense and grow in the areas that you want for the men. Now for the women, there's also some unique research and it's linked over at JoshTrent.com/541. This is going to be where you can get all the information that you're looking for when it comes to understanding fertility. We're also going to be doing a podcast here in the next couple of months with a company called Clockwise. It's a blood test that you can get to determine your age and your, I guess applicability and your capability to give birth, both the man from planting the seed as the father and the woman from having the egg and the womb as the mother. So look forward to that. Make sure you subscribe, JoshTrent.com/Podcast and make sure you are subscribed so you get notified, and when you see that clockwise episode come out, you can listen to that. So I hope that answered your question. That is probably the best episode we've done where David talks about one of the founders of MANNA Vitality. David talks about fertility and the research and all of the scientific acumen and all the energy behind MANNA. I think that'd be a really great episode for you or anyone struggling with fertility to listen to at JoshTrent.com/541. [15:30] Green Juice Benefits Okay, let's get to the final question. We talked about hot and cold therapy. We talked about why men don't do the inner work. We talked about fertility, and now we're going to talk about drinking green juice. By the way, when it comes to fertility, don't believe in the fallacy that you have to go to the doctor. None of this podcast is ever medical advice, but really the fallacy of fertility is that if you're not fertile or if you're having trouble conceiving that you have to run to the doctor, you do not. There is so much information, and so many people out there. By the way, shout out to Mimi Lindquist. This is a guest on the podcast, I think in two weeks from now. Actually, it's going to be three or four weeks from now. So look for Mimi Lindquist. She's going to be on the podcast, and she is a great resource. She and Dr. Nathan Riley when it comes to fertility, the fallacy of fertility before we get to the green juice, the fallacy of fertility is that most people believe that they should immediately take a breath and run to their physician. It's absolutely not true. There are so many things you can do before that. Boosting it with adaptogens like mana is one of them. Lifting heavy weights. If you're a man, getting good sleep, honestly, sleep is probably the main thing for all of us. If a woman's not sleeping, if a man's not sleeping, they're much, much, much, much less likely to conceive. So that's some of the truth there. Obviously, that's a way bigger conversation, but some great resources. Now, let's talk about green juice. There's @jeffturnerra on Instagram and Jeff said: "What to do when a loved one thinks your health advice is crazy when they won't drink the green juice and instead just want the doctor's pills?" Look, you don't have to have them drink the green juice, but here's what's going to happen if you do, right? There are things called adaptogens, and these adaptogens are plant compounds that are so smart that when you consume them and they go into your body, your body actually uses them as the levers and the gears and all the things that your body needs in order to be at its most optimal. Now, why is this important? Organifi Green Juice has been a sponsor and a partner for us for over 6 years. Can you believe that? I mean, there's got to be something good there. You go to JoshTrent.com/Organifi and you use the code "WELLNESSFORCE", you get 20% off, which is amazing, and you can get their Protein Powder, their Green Juice, their Red Juice, their Gold. It's fricking awesome. It's literally something that I have every day. I give it to my son. My family drinks it. I've turned a bunch of onto it. I've probably turned on at this point, over 10,000 people or more just from the podcast. There's a reason why the company's doing so great. So here's what you do, Jeff. Turn on Instagram. When a loved one thinks your health advice is crazy, show them that you're not through your results. When they think you're crazy and they themselves are unhealthy or they've got something going on with their own physicality or their digestion or their mental health, and they're not in a good place, show them with your results. The best way to create change in others is when they see the change in you. That's it full. The best way to create change in others is not by talking to them. The best way to create change in others is by letting them see the change in you. So how do you do this? Green juice is one of those things. It's the adaptogens. These plant compounds, these smart plants that go into your body and actually allow your body to be most optimal. But also, you can drink clean water. You can go over to JoshTrent.com/Store and look at specifically the hydrogen water and some of the other tools that we have there. Start where you are. By the way, financially, if you can't do any of this stuff, you don't have to do any of it. It's going to be more challenging in modernity, but it's going to be a lot easier if you just stack the environment in your favor, look at your finances, and go, okay, where am I spending money that's taken away from my health? Am I drinking? Am I eating crappy food? Am I hanging out and spending money with people that don't even love me, that I don't even care about, that doesn't even really matter to me in life? Do this change from the inside and the outside will reflect the inner game that you're starting to play. If you're interested in a new inner game, Jeff, when your loved one thinks your health advice is crazy, show them how they can change by the change they see in you. That is it full stop. Because if they won't drink the green juice and they're just going to the doctor, if they see you change, then six months from now, 12 months from now, they can't point a finger at you and be like, oh, it didn't work because it did. It obviously worked, right? Otherwise, you wouldn't be healthy. So do not use your words to spark change when it comes to family members specifically or a loved one. Use your behavior and use your results to spark that change. That's the only way that they're going to listen to you anyways. They're going to see how you look in jeans. They're going to feel your presence. They're going to understand that you're not farting around them all the time, that you have better gi, not so much GI distress. These are all the ways that you can live your life well, and if you head over to josh trend.com/podcast and josh trend.com/store, and also all the different resources that we've talked about today@joshtrend.com slash 6 09, this is going to be a great starting place for you, my friend. This is a great starting place. There are so many podcasts out there, there's so much content out there. Do me a favor. Take a deep breath, breathe it out, and just ask yourself, is what I've been doing working? Because if what you've been doing is working, then don't change anything. But if you are looking for more, if you're looking for better results, subscribe to the podcast. Go to the store page. Start using all of these free resources that are out there for you. There's an ocean of free resources, but how do you know that the person is trustworthy? Will my results speak for themselves? You can look at all of our content. You can always message me admin@wellnessforce.com. You can talk to me to my team, talk to us on Instagram at Wellness + Wisdom or at Josh Trent. That's my personal account, which I reply to. So whatever you get from this podcast, from this A MA, make sure that if you are inspired to ask questions that you ask them on Instagram and that you message me through JoshTrent.com/AMA. Remember, you can submit 90 seconds or less and we'll select your question. We'll actually put your voice in the episode so you can be heard by the entire podcast world. Okay? That ends today's AMA. Remember to submit your questions, follow us, and subscribe and get all the free stuff. It's all free for you. We live in an amazing time where you can just get so much free stuff, but are you actually using it? That is the thing. Are you actually using it? Until I talk to you again real soon, I'm wishing you love and wellness. Leave Wellness + Wisdom a Review on Apple Podcasts Josh's Trusted Products | Up To 40% Off Shop All Products Biohacking BREATHE - 33% off with the code “PODCAST33” SaunaSpace - 10% off with the code "JOSH10" PLUNGE - $150 off with the code “WELLNESSFORCE" SiPhox - 10% off with code "JOSH" BON CHARGE - 15% off with the code "JOSH15" SpectraSculpt - 15% off with the code "JOSH15" Defender Shield - Save 10% with "TRENT10" Neuvana - Save 15% with "WELLNESSFORCE" Supplements Organifi - 20% off with the code ‘WELLNESSFORCE' MANNA Vitality - 20% off with the code "JOSH20" LiftMode - Save 10% with "JOSH10" Adapt Naturals - 15% off with code "WELLNESSFORCE" MitoZen - 10% off with the code “WELLNESSFORCE” Activation Products - 20% off with the code “WELLNESSFORCE” BiOptimizers - 10% off with the code "JOSH10" Lightbody Total Eye Health - 20% off with "JOSH20" at checkout. Fitness + Physical Health Detox Dudes Online Courses - Save up to $500 with code "JOSH" SimplyO3 - 10% off with code "JOSH10" SinuSonic - 15% off with "JOSH15" Kineon - 10% off with code "JOSH10" Earth Runners Shoes - 10% off with the code "JOSH10" Drink LMNT - Zero Sugar Hydration: Get your free LMNT Sample Pack, with any purchase Haven Athletic Gym Backpacks - Use code "JOSH10" to save $40 for a limited time! ⁠Myoxcience - Save 20% with code "JOSH20" Create Wellness Creatine Gummies - 20% off with the code "JOSH20" Healthy Home QI-Shield EMF Device - 20% off with the code "JOSH" Zyppah Complete Sleep Kit - Save 20% with "JOSH" ALIVE WATERS - 33% off your first order with the code "JOSH33" Holy Hydrogen - $100 off with code "JOSH" Cozy Earth - 40% off with code "JOSH" Essential Oil Wizardry - Save 10% with code "WELLNESSFORCE" Nutrition + Gut Health SEED Synbiotic - 30% off with the code "JOSHTRENT" Zbiotics | Breakdown Alcohol Byproduct  - Save 10% with "JOSH10" Tiny Health - $20 off with "JOSH20" Paleovalley - 15% off with the link only Intelligence of Nature - 15% off with the code ‘JOSH15' ⁠EnergyBITS - 20% off with the code "WELLNESSFORCE⁠" ⁠EQUIP Foods - 15% off with the code JOSH15 DRY FARM WINES - Get an extra bottle of Pure Natural Wine with your order for just 1¢ EONS Mushroom Coffee - Save 20% with code "JOSH20" Just Thrive - Save 20% with "JOSH" Mental Health + Stress Release Mendi.io - 20% off with the code "JOSH20" Cured Nutrition CBD - 20% off with the code "WELLNESS FORCE" LiftMode - 10% off with the code "JOSH10" NOOTOPIA - 10% off with the code "JOSH10" Feel Free from Botanic Tonics - $40 off with the code "WELLNESS40" Free Resources M21 Wellness Guide - Free 3-Week Breathwork Program with Josh Trent Join Wellness + Wisdom Community MANNA Vitality The only supplement you will ever need.   Save 20% with "JOSH20"   Manna harnesses the power of nature through their Mineral Matrix blend, a unique composition of natural ingredients such as Shilajit, Ormus, and marine minerals. • Energy & Longevity • Brain Performance • Sex Drive • Immunity Defense • Beauty & Glow   This blend is designed to support overall mental and physical performance, including cognitive function and energy levels, for an overall boost in vitality. By using natural ingredients, Manna provides a safe and effective way to enhance your body's natural abilities and unlock your full potential. Manna is a combination of the highest quality minerals, amino, fulvic and humic acids and nutrients gathered from some of the highest and lowest points on the planet —the mountains and the sea—to provide a comprehensive and enhanced mineral matrix.   Save 20% with "JOSH20"   Death & Rebirth: Why I'm Saying Goodbye to Wellness Force...

Double Tap Canada
2023 Tech News Review

Double Tap Canada

Play Episode Listen Later Jan 1, 2024 56:18


In our special episode, we're revisiting the tech highlights of 2023. The year began with Sony's PlayStation 5 controller launch and Microsoft's investment in OpenAI. Twitter made waves by banning third-party apps, sparking a discussion featured in a clip with Gedeon Maheux. February brought Google's AI plans with Bard and exciting tech news from Canada. HumanWare introduced the Victor Reader Stream 3rd gen. March featured Humanware's "Made for Surface" devices and the CSUN conference. April marked Amazon's support for cochlear implants and Seeing AI's indoor navigation feature. May was packed with innovations, including Braille Doodle and Final Cut's iPad debut, alongside an audio transcription demo using AIKO. Sadly, Microsoft bid farewell to Soundscape, but it returned via Open Scape beta, the Scottish Tech Army, and the NCBI. June showcased Apple's WWDC and Vision Pro, along with Reddit's significant API changes. July was Convention month, featuring Sight Village PamTrad, NFB Report by Damashe Thomas, and ACB-OKO. August turned the spotlight to smart glasses, including Seleste and Kapsys smartvision 3. In September, LEGO launched braille bricks for everyone, while WordPress Accessibility Day emphasized web inclusivity. October unveiled CES in Amsterdam, and November featured a talking air fryer, Be My Eyes at an Open AI event, JAWS news, and some Open AI chaos. Be My AI emerged as the first customer service AI. December concluded with Forza's success at the Game Awards, the Netflix drama "All The Light We Cannot See," and the Android debut of Seeing AI and Be My AI. Sight Tech Global was a must-attend event for tech enthusiasts. Get in touch with the Double Tappers and join the conversation: Email: feedback@doubletaponair.com Call: 1-877-803-4567 (Canada and USA) / 0204 571 3354 (UK) X (formerly Twitter): @BlindGuyTech / @ShaunShed Mastodon: @DoubleTap

Irish Tech News Audio Articles
6 Out of 10 People in Ireland Would Be Thrilled to Receive a Charity Shop Gift This Christmas

Irish Tech News Audio Articles

Play Episode Listen Later Dec 11, 2023 3:14


The hidden potential for Christmas gift bargains has been revealed in a new survey for Vision Ireland, the new name for NCBI, which operates 124 retail outlets across the country. The survey of 1000 people conducted by Bounce Insights for Vision Ireland shows that almost 60% of respondents would be delighted to receive a pre-loved gift that was bought in a charity shop. However, less than 30% said they would be browsing a charity shop in the lead-up to Christmas, suggesting that many of us could miss out on some smart gifting solutions that are likely to be well-received by our loved ones. The survey also suggests reasons why these gifts are so popular. For instance, 59% of respondents see charity shops as a source of high-quality and unique fashion items. And shopping sustainably is also a great motivation - 40% of shoppers think that when it comes to Christmas shopping, buying sustainably is one of their most important priorities. And this is an increasing trend, with 28% seeing sustainability as even more important this Christmas versus last year. Young adults aged 18-24 place the biggest importance on sustainability (50%), but surprisingly, the next highest group is the older generation 55+ (at 45%) Commenting on the findings, Beverley Scallan, Chief Commercial Officer of Vision Ireland, said, "The survey reveals a surprising contradiction with shoppers in Ireland. While most of us would be delighted to receive a pre-loved gift from a charity shop, not as many of us are planning to buy a pre-loved gift to give to others, all the while saying that sustainability is a high priority for us this Christmas. And so shopping at a Vision Ireland charity shop satisfies people's aspirations to shop sustainably while ensuring they'll find pre-loved gifts that their loved ones will be delighted with. What's more, the survey shows that people recognise they are great places to find high quality, unique pieces - not such a surprise, considering much of our stock is actually brand new, with the labels still on as well as designer brands that are only available otherwise in high-end retail stores. Scallan continued: "Vision Ireland charity shops sell around two million pieces of clothing, furniture and much else, which otherwise would be destined for the landfill. The stores, which are located across Ireland, handle about 1,850 tonnes of donations a year. Additionally, 90% of all donations are resold, and the remainder is recycled. That works out to about 5,900 tonnes of C02 and about 10 billion litres of water a year saved by shopping for preloved items in Vision Ireland stores. "When you consider the range of high-quality pre-loved products available at charity shops such as Vision Ireland, it's not surprising that people want to receive these items as gifts while ensuring that we are keeping the circular economy ticking over. This Christmas, it's definitely worth popping in to see if you can pick up that special and unique gift you might be struggling to find elsewhere."

Vayse
VYS0031 | The Truman Show? - Vayse to Face with Willow Truman

Vayse

Play Episode Listen Later Nov 29, 2023 69:14


VYS0031 | The Truman Show? - Vayse to Face with Willow Truman We interrupt your regularly scheduled reality to bring you a broadcast directly from the weird and wonderful mind of researcher and podcaster Willow Truman, co-host of the superlative Nonsense Bazaar podcast. Willow pulls Hine and Buckley straight into the eye of her synchronicity storm as reality itself begins to unfurl - do we live in someone else's reality or do we create our own? Which non-human entity convinced Willow to quit smoking? How did peanut butter nearly derail the entire interview? ... and can anyone remember the fifth Teletubby?... (recorded 20 November 2023) Thanks again to Keith for the show notes. Willow / The Nonsense Bazaar The Nonsense Bazaar website (https://thenonsensebazaar.com/) The Nonsense Bazaar on X/Twitter (https://twitter.com/nonsensebazaar) The Nonsense Bazaar on Instagram (https://www.instagram.com/thenonsensebazaar/) The Nonsense Bazaar Patreon (https://www.patreon.com/thenonsensebazaar) Introduction John Doggett - Wikipedia (https://en.wikipedia.org/wiki/John_Doggett) Monica Reyes - Wikipedia (https://en.wikipedia.org/wiki/Monica_Reyes) Richard ‘Ringo' Langly - X-Files Wiki (https://x-files.fandom.com/wiki/Richard_Langly) Melvin Frohike - X-Files Wiki (https://x-files.fandom.com/wiki/Melvin_Frohike) The Lone Gunmen - Wikipedia (https://en.wikipedia.org/wiki/The_Lone_Gunmen) Duane Barry - X-Files Wiki (https://x-files.fandom.com/wiki/Duane_Barry) Eugene Victor Tooms - X-Files Wiki (https://x-files.fandom.com/wiki/Eugene_Victor_Tooms) Mr X (The X-Files) - Wikipedia (https://en.wikipedia.org/wiki/X_(The_X-Files)) Alex Krycek - Wikipedia (https://en.wikipedia.org/wiki/Alex_Krycek) Eve 6 - X-Files Wiki (https://x-files.fandom.com/wiki/Eve_6) Eve 6 (band) - Wikipedia (https://en.wikipedia.org/wiki/Eve_6) Flukeman - X-Files Wiki (https://x-files.fandom.com/wiki/Flukeman) Nominative determinism - Wikipedia (https://en.wikipedia.org/wiki/Nominative_determinism) Aptronym - Wikipedia (https://en.wikipedia.org/wiki/Aptronym) The name thing, and Willow's recent experience of reality Splendor Solis - Wikipedia (https://en.wikipedia.org/wiki/Splendor_Solis) Morbid Anatomy website (https://www.morbidanatomy.org/) Self-concept Wikipedia (https://en.wikipedia.org/wiki/Self-concept) The Frame (film, 2014) - Wikipedia (https://en.wikipedia.org/wiki/The_Frame_(film)) The Frame Trailer (https://www.youtube.com/watch?v=RXh8ARkkwAo) The Truman Show - Wikipedia (https://en.wikipedia.org/wiki/The_Truman_Show) The Truman Show Trailer (https://www.youtube.com/watch?v=dlnmQbPGuls) Sequoyah Kennedy - Twitter (https://twitter.com/sequoyahkennedy) Barbie (film) - Wikipedia (https://en.wikipedia.org/wiki/Barbie_(film)) Barbie film script excerpt: “A podcast hosted by two wise trees.” (https://imgur.com/a/NvYJdjX) Synchronicity - Wikipedia (https://en.wikipedia.org/wiki/Synchronicity) Peanut Butter - Wikipedia (https://en.wikipedia.org/wiki/Peanut_butter) Squirrel - Wikipedia (https://en.wikipedia.org/wiki/Squirrel) Nutjob - Free Dictionary (https://idioms.thefreedictionary.com/nut+job) The Synchronicity Storm – Exploring the Portals of Perception - Troubled Minds (https://troubledminds.org/the-synchronicity-storm-exploring-the-portals-of-perception/) Alchemical tree - Science Photo (https://www.sciencephoto.com/media/148726/view/alchemical-tree-philosophia-reformata) Ayla (name) - Wikipedia (https://en.wikipedia.org/wiki/Ayla_(name)#Hebrew) Personal identity (metaphysics) - Britannica (https://www.britannica.com/topic/personal-identity) All science is provisional - Cambridge Network (https://www.cambridgenetwork.co.uk/news/all-science-provisional) True Will - Wikipedia (https://en.wikipedia.org/wiki/True_Will) Infinity mirror - Wikipedia (https://en.wikipedia.org/wiki/Infinity_mirror) Heraclitus: Life Is Flux, World History (https://www.worldhistory.org/article/75/heraclitus-life-is-flux/) How Our Name Affects Our Personality and Identity: What Social Psychology Says - Exo Insight (https://insight.openexo.com/how-our-name-affects-our-personality-and-identity-what-social-psychology-says/) Persona (concept) - Wikipedia (https://en.wikipedia.org/wiki/Persona) Velvet Goldmine (film, 1998) - Wikipedia (https://en.wikipedia.org/wiki/Velvet_Goldmine) Velvet Goldmine Trailer (https://www.youtube.com/watch?v=Kqd8ChJ5xLk) David Bowie - Wikipedia (https://en.wikipedia.org/wiki/David_Bowie) Iggy Pop - Wikipedia (https://en.wikipedia.org/wiki/Iggy_Pop) Oscar Wilde - Wikipedia (https://en.wikipedia.org/wiki/Oscar_Wilde) Oscar Wilde quote: “Give him a mask…” (https://www.azquotes.com/quote/314515) Halloween and Fancy Dress, the psychology of dressing up - Psychology Today (https://www.psychologytoday.com/gb/blog/in-excess/201610/halloween-and-fancy-dress) Self, Wikipedia (https://en.wikipedia.org/wiki/Self) Robert Anton Wilson - Wikipedia (https://en.wikipedia.org/wiki/Robert_Anton_Wilson) Aleister Crowley - Wikipedia (https://en.wikipedia.org/wiki/Aleister_Crowley) Willow and the Fifth Teletubby The Trouble with "Main Character Syndrome" - Psychology Today (https://www.psychologytoday.com/us/blog/digital-world-real-world/202106/the-trouble-main-character-syndrome) Mandela effect - Wikipedia (https://en.wikipedia.org/wiki/False_memory#Mandela_effect) Teletubbies - Wikipedia (https://en.wikipedia.org/wiki/Teletubbies) Teletubbies Theme Song (https://www.youtube.com/watch?v=oJ8CXngwvbU) Flammarion engraving - Wikipedia (https://en.wikipedia.org/wiki/Flammarion_engraving) Lemuria - Wikipedia (https://en.wikipedia.org/wiki/Lemuria) The Sheridan Tapes podcast - Apple podcasts (https://podcasts.apple.com/gb/podcast/the-sheridan-tapes/id1508614133) TV Demonism, concerning the missing fifth Teletubby - Hyperstition blog-post (http://hyperstition.abstractdynamics.org/archives/006061.html) Ayahuasca - Wikipedia (https://en.wikipedia.org/wiki/Ayahuasca) What does Willow think reality is? Philip K Dick quote: “Reality is…” (https://www.azquotes.com/quote/77878) Robert Anton Wilson quote: “…reality is…” (https://www.azquotes.com/quote/344701) Danny Jones Podcast: #189 - Psychonauts Are Now Mapping Hyper-Dimensional Worlds | Andrew Gallimore (https://podcasts.apple.com/gb/podcast/danny-jones-podcast/id1441238966?i=1000616527270) Dr Andrew Gallimore profile - DMT Quest (https://dmtquest.org/dr-andrew-gallimore/) DMT - Wikipedia (https://en.wikipedia.org/wiki/N,N-Dimethyltryptamine) DMT Entities Wiki (https://wiki-entities.dmt-vision.net/) Hallucination - Wikipedia (https://en.wikipedia.org/wiki/Hallucination) Linguistic relativity (https://en.wikipedia.org/wiki/Linguistic_relativity) Willow's telescope moment and the battle for her soul Psychedelic experience (https://en.wikipedia.org/wiki/Psychedelic_experience) High Holy Days (Ten days of Awe) - Wikipedia (https://en.wikipedia.org/wiki/High_Holy_Days) Book of life - Wikipedia (https://en.wikipedia.org/wiki/Book_of_Life) Cape Cod - Wikipedia (https://en.wikipedia.org/wiki/Cape_Cod) Abraxas - Wikipedia (https://en.wikipedia.org/wiki/Abraxas) Osiris - Wikipedia (https://en.wikipedia.org/wiki/Osiris) Taxi Driver (film) - Wikipedia (https://en.wikipedia.org/wiki/Taxi_Driver) Taxi Driver (1976) Official Trailer (https://www.youtube.com/watch?v=T5IligQP7Fo) Are we are living in a simulation? Simulation hypothesis - Wikipedia (https://en.wikipedia.org/wiki/Simulation_hypothesis) Reality tunnel - Wikipedia (https://en.wikipedia.org/wiki/Reality_tunnel) Psychedelic drug - Wikipedia (https://en.wikipedia.org/wiki/Psychedelic_drug) MI6 - Wikipedia (https://en.wikipedia.org/wiki/MI6) Chapel Perilous - Wikipedia (https://en.wikipedia.org/wiki/Chapel_perilous) Cosmic Trigger - Wikipedia (https://en.wikipedia.org/wiki/Cosmic_Trigger_I:_The_Final_Secret_of_the_Illuminati) The Great and Secret Show (novel by Clive Barker) - Wikipedia (https://en.wikipedia.org/wiki/The_Great_and_Secret_Show) Derren Brown - Wikipedia (https://en.wikipedia.org/wiki/Derren_Brown) Reactivity (psychology) - Wikipedia (https://en.wikipedia.org/wiki/Reactivity_(psychology)) Surveillance state - Wikipedia (https://en.wikipedia.org/wiki/Mass_surveillance) Reality television - Wikipedia (https://en.wikipedia.org/wiki/Reality_television) Social media - Wikipedia (https://en.wikipedia.org/wiki/Social_media) How Social Media Is Changing Our Brains - MMHPI (https://mmhpi.org/topics/in-the-news/how-social-media-is-changing-our-brains/) The “online brain”: how the Internet may be changing our cognition - NCBI (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6502424/) Impossible questions, and feeling like an alien Chaos magic - Wikipedia (https://en.wikipedia.org/wiki/Chaos_magic) Chicken or the egg - Wikipedia (https://en.wikipedia.org/wiki/Chicken_or_the_egg) Addiction - Wikipedia (https://en.wikipedia.org/wiki/Addiction) The Devil (tarot card) - Wikipedia (https://en.wikipedia.org/wiki/The_Devil_(tarot_card)) Star people (New Age) - Wikipedia (https://en.wikipedia.org/wiki/Star_people_(New_Age)) Starseeds: psychologists on why some people think they're aliens living on Earth, The Conversation (https://theconversation.com/starseeds-psychologists-on-why-some-people-think-theyre-aliens-living-on-earth-197291) Disassociation (psychology) - Wikipedia (https://en.wikipedia.org/wiki/Dissociation_%28psychology%29) The Nonsense Bazaar #80 - Harriet Tubman, Psychic Spy (https://thenonsensebazaar.com/listen/80-harriet-tubman-psychic-spy/) Astrology - Wikipedia (https://en.wikipedia.org/wiki/Astrology) Twelfth House - Astrology (https://www.astrology.com/houses/twelfth-house) Human, alien, other: Why we're all still in love with David Bowie - The Guardian (https://www.theguardian.com/music/2021/jan/10/human-alien-other-why-were-all-still-in-love-with-david-bowie) The Nonsense Bazaar and Willow's shift in reality Information addiction: How information is like snacks, money, and drugs to your brain, Neuroscience (https://neurosciencenews.com/information-addiction-brain-14274/) Reddit - Wikipedia (https://en.wikipedia.org/wiki/Reddit) 4chan - Wikipedia (https://en.wikipedia.org/wiki/4chan) Social media as a news source - Wikipedia (https://en.wikipedia.org/wiki/Social_media_as_a_news_source) The Nonsense Bazaar #41 - Dimensional Breach in the Paris Catacombs (https://thenonsensebazaar.com/uncategorized/41-dimensional-breach-in-the-paris-catacombs/) u/snappedfingers - Redditor´s Obscure Disappearance (https://www.youtube.com/watch?v=LK9B5epT8oo&t=11s) Discord: Criticisms and controversies - Wikipedia (https://en.wikipedia.org/wiki/Discord#Criticisms_and_controversies) Which Nonsense Bazaar research topics have frightened Willow? The Nonsense Bazaar #112 - The Bodysnatchers: A very real alien conspiracy (https://thenonsensebazaar.com/listen/112-the-bodysnatchers-a-very-real-alien-conspiracy/) The Nonsense Bazaar (Unlocked Bonus Episode): Orin and Daben Awaken Your Light Body (https://thenonsensebazaar.com/listen/unlocked-bonus-episode-orin-daben-awaken-your-light-body/) Was alien obsessed Midland woman murdered in the Bahamas? - Birmingham Mail (https://www.birminghammail.co.uk/news/local-news/was-alien-obsessed-midland-woman-murdered-246643) Destructive cults - Wikipedia (https://en.wikipedia.org/wiki/Cult#Destructive_cults) Doomsday cult - Wikipedia (https://en.wikipedia.org/wiki/Doomsday_cult) Aum Shinrikyo - Wikipedia (https://en.wikipedia.org/wiki/Aum_Shinrikyo) The Nonsense Bazaar #115 - Aum Shinrikyo Part I: The G.O.A.T. (https://thenonsensebazaar.com/listen/115-aum-shinrikyo-part-i-the-g-o-a-t/) The Nonsense Bazaar #116 - Aum Shinrikyo Part II: The Guru's love (https://thenonsensebazaar.com/listen/116-aum-shinrikyo-part-ii-the-gurus-love/) The Nonsense Bazaar #117 - Aum Shinrikyo Part III: The Wizard (https://thenonsensebazaar.com/listen/117-aum-shinrikyo-part-iii-the-wizard/) “I AM” activity - Wikipedia (https://en.wikipedia.org/wiki/%22I_AM%22_Activity) The Nonsense Bazaar #23 - The “I AM” Activity Part I: Saint Germain‘s Cup of Cream (https://thenonsensebazaar.com/listen/23-the-i-am-activity-part-1-saint-germains-cup-of-cream/) The Nonsense Bazaar #24 - The ”I AM” Activity Part II: Death Blasts Over The White House (https://thenonsensebazaar.com/listen/24-the-i-am-activity-part-ii-death-blasts-over-the-white-house/) The Nonsense Bazaar #71 - The Benadryl Episode: A Trip to Eiriel (https://thenonsensebazaar.com/listen/71-the-benadryl-episode-a-trip-to-eiriel/) Benadryl - Wikipedia (https://en.wikipedia.org/wiki/Benadryl) How the ‘Hat Man' Went From Benadryl Joke to TikTok Horror Villain - Rolling Stone (https://www.rollingstone.com/culture/culture-features/hat-man-benadryl-tiktok-monster-1234620397/) Diana Walsh Pasulka - Wikipedia (https://en.wikipedia.org/wiki/Diana_Walsh_Pasulka) Diana Walsh Pasulka website (https://dwpasulka.com/) Encounters: Experiences with Non-human Intelligences by D.W. Pasulka - Goodreads (https://www.goodreads.com/book/show/65213521-encounters) Encounters: Experiences with Non-human Intelligences by D. W. Pasulka (to buy) (https://uk.bookshop.org/p/books/encounters-experiences-with-nonhuman-intelligences-d-w-pasulka/7536571) Hat-trick (magic trick) - Wikipedia (https://en.wikipedia.org/wiki/Hat-trick_(magic_trick)) Count of St Germain - Wikipedia (https://en.wikipedia.org/wiki/Count_of_St._Germain) The Nonsense Bazaar #20 - The Count of St Germain (https://thenonsensebazaar.com/listen/20-the-count-of-st-germain/) The COVID-19 Pandemic and weird stuff The Ravaged Psyche: Impact of the COVID-19 Pandemic on the Human Mind, National Library of Medicine (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7840618/) The Rhythm of the Night (song), Wikipedia (https://en.wikipedia.org/wiki/The_Rhythm_of_the_Night) Corona - The Rhythm of the Night (Official Music Video) (https://www.youtube.com/watch?v=OnT58cIJSpw) Sahasrara (Crown Shakra) - Wikipedia (https://en.wikipedia.org/wiki/Sahasrara) Solar eclipse of August 11, 1999 - Wikipedia (https://en.wikipedia.org/wiki/Solar_eclipse_of_August_11%2C_1999) Liminality - Wikipedia (https://en.wikipedia.org/wiki/Liminality) Liminalist Podcast # 2: All Bollixed Up, A Liminal Dialogue with George P. Hansen (https://auticulture.com/liminalist-2-bollixed-liminal-dialogue-george-p-hansen/) A Year of the Pandemic: How Have Birds and Other Wildlife Responded? - Audobon (2021) (https://www.audubon.org/news/a-year-pandemic-how-have-birds-and-other-wildlife-responded) 28 Days Later - Wikipedia (https://en.wikipedia.org/wiki/28_Days_Later) 28 Days Later Official Trailer (https://www.youtube.com/watch?v=FcDhdb6J3rM) The Secret of the Violet Flame - Violet Flame (https://www.violetflame.com/the-secret-of-the-violet-flame/) 2016: Celebrity Big Brother, “David is dead”, the plot to kill Elton John, and The Wizard of Oz Celebrity Big Brother (British series 17) - Wikipedia (https://en.wikipedia.org/wiki/Celebrity_Big_Brother_(British_series_17)) Celebrity Big Brother's Tiffany misunderstands Bowie death - BBC News (https://www.bbc.co.uk/news/newsbeat-35299717) Angie Bowie - Wikipedia (https://en.wikipedia.org/wiki/Angie_Bowie) Tiffany Pollard - Wikipedia (https://en.wikipedia.org/wiki/Tiffany_Pollard) David Gest - Wikipedia (https://en.wikipedia.org/wiki/David_Gest) David Gest, Plot to kill Elton John - Wikipedia (https://en.wikipedia.org/wiki/David_Gest#Plot_to_kill_Elton_John) Liza Minelli - Wikipedia (https://en.wikipedia.org/wiki/Liza_Minnelli) Judy Garland - Wikipedia (https://en.wikipedia.org/wiki/Judy_Garland) Dorothy Gale - Wikipedia (https://en.wikipedia.org/wiki/Dorothy_Gale) The Wizard of Oz (1939 film) - Wikipedia (https://en.wikipedia.org/wiki/The_Wizard_of_Oz_(1939_film)) The Wizard of Oz - 4K Trailer (https://www.youtube.com/watch?v=b_A2twyZevo) The Wizard of Oz: The “Pay no attention to the man behind the curtain” scene (https://www.youtube.com/watch?v=YWyCCJ6B2WE) Labyrinth (1986 film) - Wikipedia (https://en.wikipedia.org/wiki/Labyrinth_(1986_film)) Labyrinth (1986) Official Trailer (https://www.youtube.com/watch?v=O2yd4em1I6M) Puzzle Box - Wikipedia (https://en.wikipedia.org/wiki/Puzzle_box) Willow's recommendations The Frame (2014) - where to watch online (https://www.justwatch.com/uk/movie/the-frame) De rerum natura (On the Nature of Things) by Lucretius - Wikipedia (https://en.wikipedia.org/wiki/De_rerum_natura) Buckley's closing question Divine (performer) - Wikipedia page (https://en.wikipedia.org/wiki/Divine_(performer)) Vayse online Vayse website (https://www.vayse.co.uk/) Vayse on Twitter (https://twitter.com/vayseesyav) Vayse on Instagram (https://www.instagram.com/vayseesyav/) Music From Vayse - Volume 1 by Polypores (https://vayse.bandcamp.com/album/music-from-vayse-volume-1) Vayse on Ko-Fi (https://ko-fi.com/vayse) Vayse email: vayseinfo@gmail.com Special Guest: Willow Truman.

Galway Bay Fm - Galway Talks - with Keith Finnegan
Galway Talks with John Morley (Wednesday, 22nd November 2023) - 9am-10am

Galway Bay Fm - Galway Talks - with Keith Finnegan

Play Episode Listen Later Nov 22, 2023 35:54


On today's show: 9am-10am Gort Biogas Concern Group win- ABP concede case this morning  IA Labs, a branch of the NCBI, release their annual Digital Accessibility Report   Local councillor raises concern that risk based assessment for social housing list is not fit for purpose  Children's book. Máistir Leon ag Taisteal, Mr.lion on Tour == 'Galway Talks' broadcasts every weekday morning from 9am on Galway Bay FM.

Heal NPD
5 Common Misconceptions about NPD

Heal NPD

Play Episode Listen Later Nov 13, 2023 27:27


In this episode, Dr. Ettensohn addresses 5 common misconceptions about pathological narcissism and NPD: 1. NPD is not a mental illness 2. NPD is not treatable 3. Even if NPD is treatable, actual healing is impossible 4. All individuals with NPD are abusers 5. People with NPD change their behavior behind closed doors, so they can't be mentally ill Using authoritative mental health resources like the American Psychiatric Association, American Psychological Association, National Institutes of Health, and the Domestic Abuse Hotline; as well as reference to peer-reviewed literature, Dr. Ettensohn discusses each of these misconceptions and why they are mistaken. Purchase Unmasking Narcissism: A Guide to Understanding the Narcissist in Your Life here: https://amzn.to/3nG9FgH   VISIT THE WEBSITE: https://www.drettensohn.com/ Cited References: Alexander. (n.d.). Abuse and mental illness: Is there a connection? National Domestic Violence Hotline. https://www.thehotline.org/resources/abuse-and-mental-illness-is-there-a-connection/ American Psychiatric Association. (2013). Diagnostic and statistical manual of mental disorders (5th ed.). Washington, D.C.: American Psychiatric Association. American Psychiatric Association. (2022). Diagnostic and statistical manual of mental disorders (5th ed., text revision). Washington, D.C.: American Psychiatric Association. American Psychiatric Association. (n.d.). What is mental illness? https://www.psychiatry.org/patients-families/what-is-mental-illness American Psychological Association. (n.d.). Splitting. APA Dictionary of Psychology. https://dictionary.apa.org/splitting Cooper, A. M., & Michels, R. (1988). [Review of Diagnostic and statistical manual of mental disorders (3rd ed., rev.)]. American Journal of Psychiatry, 145, 1300-1301. Freud, S. (1914). On narcissism. SE, 14, 67-102. London: The Hogarth Press. National Institutes of Health. (n.d.). Information about mental illness and the brain. NCBI. https://www.ncbi.nlm.nih.gov/books/NBK20369/ Ronningstam, E. & Weinberg, I. (2013). Narcissistic personality disorder: Progress in recognition and treatment. Focus: The Journal of Lifelong Learning in Psychiatry, 11(2), 167-177.

Double Tap Canada
Soundscape Community

Double Tap Canada

Play Episode Listen Later Oct 23, 2023 55:45


Today on the show, Steven and Shaun are joined by three special guests to discuss the future of a popular orientation and mobility app for people who are blind. Since Soundscape was "sunset" by Microsoft earlier this year, many have rushed to recreate the app using the source code the company provided, and one of those groups has been led in part by the app's original co-founder, Jarnail Chudge. Today on Double Tap we meet Jarnail, along with two members of the NCBI (The National Council for the Blind in Ireland) who are helping to back this new project. David Redmond and Aiofe Buckley discuss the benefits of the app from David's perspective as a person who is blind as well as Aiofe, who is an orientation and mobility instructor. You can find out more about the NCBI here: https://www.ncbi.ie You can also download the Soundscape Community app (for iPhone only) here: https://apps.apple.com/us/app/soundscape-community/id6449701760 Get in touch with the Double Tappers and join the conversation: Email: feedback@doubletaponair.com Call: 1-877-803-4567 (Canada and USA) / 0204 571 3354 (UK) X (formerly Twitter): @BlindGuyTech / @ShaunShed Mastodon: @DoubleTap

You Learn You Turn
Nate Randle of Gabb Wireless discusses the mental health crisis facing our youth today

You Learn You Turn

Play Episode Listen Later Oct 5, 2023 32:04


According to NCBI suicide is the second leading cause of death in youth aged 10–24 years old. They also found an association between increased social media/internet use and suicide attempts in seven studies.Nate Randle is on a mission to change these statistics by providing an alternative to a smart phone. As he tells us in this podcast, its about more than just safe tech, it's about letting these kids know we care and that they are not alone. In a world of 24/7 digital connection, we are raising the lonliest generation.As CEO of Gabb Wireless, Nate brings years of experience and expertise to the nation's leading kid-safe tech company.Nate has held pivotal leadership positions at major companies like Nike, Callaway Golf, Qualtrics, and the Utah Jazz. He joined Gabb in June 2021 as the CMO and took on the CEO role in November 2021.Nate is a husband and father of four. He places the highest priorities on people and family. His focus on family directly translates into his leadership at Gabb, where protecting kids and encouraging a stronger connection between families are core to the Gabb mission.

Blind Guys Chat
#080: Time for a bath

Blind Guys Chat

Play Episode Listen Later Sep 21, 2023 56:57


Hello our little ducklings and welcome. First things first: Some of you did not believe that Stuart did in fact climb Mount Kilimanjaro. Well... we have proof! For those of you who have not seen this picture of Stuart standing at the top click on this link and you will have your proof. (Before you scold us – there is alt text, don't worry!)   Now, on with the show. Yes, it is number 80 which in numerology terms is a symbol of abundance and prosperity. “If you have been working hard towards your goals, the universe is letting you know that your efforts will be rewarded.” So that means the Blind Guys are stuffed, because as you know, we're a bunch of slackers.   Jan and Óran have recently experienced some issues with taxis - we want to know if there is government legislation in your country which prevents a taxi driver from refusing you and your guide dog? Let us know: blindguyschat@gmail.com   Do you look forward to autumn? Well, someone on the team thinks Óran is too cynical, and especially about autumn. Yes he hates autumn and winter almost as much as he hates the fact that iPhones have the best screen reader available for smartphones. Talking about poxy iPhones, will you be purchasing a new iPhone 15 or are you like the Blind Guys and are completely fed up with the lack of innovation from Apple lately?   Stuart has ordered a Sky Stream box, but will it live up to all the hype? And how does Stuart feel about not being able to record content? Mr Cynical is querying if Stuart will be able to watch the content he wants with audio description via the 'on demand' section. Stuart has also hinted that he might record a demo of setting up the box etc but Jan and Óran reckon he will make some excuse for not doing this for the next show, probably something like having to sack his pool boy for not cleaning the pool correctly...   BTW, don't forget that you can now use the Be My Eyes app to get in direct contact with a Sky rep to get real time video assistance if you ever need help.   Our guests this week are Peter O'Toole and Eleanor Martha Burke who are here to talk about “forest bathing”. Peter is Head of Counselling at NCBI and has recently started this “Role of Nature in Health and Wellbeing Series” so that people with vision impairments can get the benefits of being outdoors and bonding with nature. Eleanor gives us her views on a recent event that Peter hosted in Co. Wicklow. Mr Cynical-pants was not overly enthusiastic, but Clodagh highly recommends it. If you are interested in attending the next event in October you can find out more, and register your place here: www.ncbi.ie/event/the-role-of-nature-in-health-and-wellbeing-series-final-in-person-event-for-2023/   We have emails from Ana Cody who thinks our guest from ep 73 has a yummy voice and also has strong opinions on beer slushies at the summit of Mount Kilimanjaro. We have Axel in Sweden (cool name, Axel!) who liked our chat with Tim Dixon, and would like to know about any upcoming assistive technology events. Well Axel, you can check out www.qac.ac.uk - you can find all the info within the “exhibitions” and “news/events” sections; and you never know, you might see the Blind Guys at some of these events. Also, Ms Cavendish sends in a request/threat to spank Óran. Ooh la la!   So, strip down to your birthday suit and lie on the forest bath floor, ignore the swarm of midges going to town on your nether regions, and bask in the petrichor that is: Blind Guys Chat.   4 out of 5 trees prefer it to bark.   Support Blind Guys Chat by contributing to their tip jar: https://tips.pinecast.com/jar/blind-guys-chat

Double Tap Canada
iOS 17 Is Out, But Should You Upgrade?

Double Tap Canada

Play Episode Listen Later Sep 18, 2023 56:30


Today on the show, Steven and Shaun discuss the new features available from today in the latest iOS update for iPhones.There's also more of your feedback, including concerns about using X as an average user, comments about the new SoundScape app from NCBI in Ireland. Listeners also chime in with their stories of dealing with people who don't understand sight loss or disability in any way.Get in touch with the Double Tappers and join the conversation:Email: feedback@doubletaponair.comCall: 1-877-803-4567 (Canada and USA) / 0204 571 3354 (UK)X (formally Twitter): @BlindGuyTech / @ShaunShedMastodon: @DoubleTapYouTube: DoubleTapOnAir   

History Is Dank
DANK OFF: Medical Marvels Of The 19th Century

History Is Dank

Play Episode Listen Later Aug 22, 2023 47:12


Medical treatment before many of the inventions/theories/methods covered in this episode would have been brutal to say the least. Which of these advances in medicine had the longest lasting impact on humanity?  Get started RIGHT NOW, with 55% off your Babbel subscription. Go to Babbel.com/DANK. Stop wiping and start washing.  Go to HELLOTUSHY.com/DANK and use promo code DANK for 10% off your first order. patreon.com/striderwilson Sources: Historyextra.com ‘Victorian Medicine: Why the 19th Century was a Time of Seismic Medical Change' by Charlotte Hodgman 2022, Interestingengineering.com, Nobelprize.org, Ncbi.nlm.nih.gov ‘Edward Jenner and the history of smallpox and vaccination' by Stephan Riedal 2005, Nationalgeographic.org

RTÉ - Morning Ireland
Survey shows 40% of NCBI service users have been injured due to obstacles on footpaths

RTÉ - Morning Ireland

Play Episode Listen Later Aug 21, 2023 4:07


Chantelle Smith, National Council for the Blind Ireland, National Access and Mobility Manager discusses their Clear Our Paths campaign.

The School of Doza Podcast
Pimple Problems: Breaking Down Acne's Root Causes and Proven Solutions

The School of Doza Podcast

Play Episode Listen Later Jun 14, 2023 33:24


Join Nurse Doza as he delves into the complex world of acne, a condition affecting millions worldwide. This episode will enlighten listeners about the various factors that contribute to acne, including hormonal fluctuations, dietary influences, lifestyle habits, and more. Nurse Doza brings his wealth of experience in treating patients with acne and emphasizes the significance of addressing acne's root causes for truly effective, long-lasting solutions.   Timestamps: 00:00 - Introduction 01:14 - Defining Acne: An Overview 05:20 - Root Cause 1: Inflammation and Acne 10:16 - Root Cause 2: Bacterial Overgrowth and Acne 15:24 - Root Cause 3: Hormonal Imbalance and Acne 21:13 - Root Cause 4: Dietary Influence and Acne 25:42 - Root Cause 5: Impact of Certain Medications on Acne 30:57 - Wrap-up and Final Thoughts Unleash Your Skin's Potential with MSW Nutrition's Liver Love Take control of your acne with MSW Nutrition's Liver Love, a formulation designed to support optimal liver health and hormone balance. By addressing the root causes of acne, Liver Love can help you achieve healthier, clearer skin. Shop MSW Liver Love Here and start your journey to healthier skin today.   SHOW NOTES: Delve deeper into the intricacies of acne with the below topics discussed during the episode: 1. Understanding Acne: The Basics - A look at what acne is and how it forms. 2. Inflammation: A Key Culprit in Acne - How inflammation can contribute to acne and potential solutions. 3. Bacterial Overgrowth: An Unseen Enemy** - Examining the impact of bacterial overgrowth on acne and potential remedies. 4. **Hormonal Imbalance: A Silent Trigger** - The link between hormonal imbalances and acne, and how to counteract it. 5. **Food Sensitivity: An Unexplored Factor** - Discussing how certain foods can potentially trigger acne. 6. **Medications: A Double-Edged Sword** - Analyzing how certain medications can lead to acne breakouts. 7. **Liver Health: The Unsung Hero** - The critical role liver health plays in maintaining hormonal balance and healthy skin, and how Liver Love can provide the needed support. REFERENCES: Understanding Acne: The Basics - National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS). Inflammation: A Key Culprit in Acne - Recent advances in understanding Propionibacterium acnes (Cutibacterium acnes) in acne, NCBI. Bacterial Overgrowth: An Unseen Enemy - How is folliculitis related to acne?, LearnSkin, Folliculitis: Symptoms and Causes, Mayo Clinic, and Recent advances in understanding Propionibacterium acnes (Cutibacterium acnes) in acne, NCBI. Hormonal Imbalance: A Silent Trigger - The Role of Estrogen in Acne, Acne.org, Conversion of estrone to estradiol and estradiol to estrone in postmenopausal women, PubMed, and Influence of Age and Obesity on Serum Estradiol, Estrone, and Sex Hormone Binding Globulin Concentrations following Oral Estrogen Administration in Postmenopausal Women, NCBI. Food Sensitivity: An Unexplored Factor - Milk consumption and acne in teenaged boys, NCBI, Acne and Gut Health, Weston A Price Foundation, and Milk consumption and acne in adolescent girls, PubMed. Medications: A Double-Edged Sword - What medications can cause acne?, Acne.org.  

The VBAC Link
Episode 236 Carlise's VBAC + Signing an AMA

The VBAC Link

Play Episode Listen Later May 24, 2023 52:34


When the empowering VBAC experience she envisioned took a hostile and combative turn, Carlise knew she needed to change birth locations immediately. Though signing an AMA was not something she thought she would ever have to do, Carlise found the strength to fight for the birth she deserved. Her thorough research and supportive husband and doula gave her the confidence to not tolerate a doctor's inappropriate behavior.Meagan shares the pros and cons regarding AMA forms to help you feel educated if you find yourself in a situation similar to Carlise. While it was extremely difficult, leaving that first hospital during labor was ultimately what allowed Carlise to have her beautiful, unmedicated VBAC!Additional LinksCarlise's InstagramAMA ArticleHow to VBAC: The Ultimate Prep Course for ParentsThe VBAC Link Facebook CommunityFull Transcript under Episode DetailsMeagan: Hello, hello. You are listening to The VBAC Link and we have another story for you today. We have our friend Carlise and she is from all over the place but she is in Texas currently. This is where you had your VBAC. In Texas?Carlise: Yeah, so both of my pregnancies have been here in El Paso, Texas. Meagan: Perfect. She had a VBAC in Texas and she had a wild journey kind of similar to a month or two ago, I want to say maybe it was Morgan where she had to sign an AMA and leave while in active labor. We are going to talk a little bit about AMAs today as well in addition to her VBAC because it's something that we don't talk about a ton. If you don't know what AMA is, it's against medical advice. That is a form that we would have to sign to pretty much say that we are leaving against medical advice but sometimes we are put in situations– and I'll share a story that I've been to as a doula– where we feel that we have to sign these AMAs. Review of the WeekIn this situation, you signed the AMA and went on to another hospital and had a VBAC and a different experience. So we'll talk a little bit about AMAs but first, we have a Review of the Week as always. Just a reminder, if you haven't left a review, we would love your review. You can leave it on Apple Podcasts or on Google. You can just search for The VBAC Link on Google. You can email us at info@thevbaclink.com or wherever you listen to your podcasts. We love your reviews. This is from runnervt. It says, “This podcast helped me get my VBAC.” It says, “I started listening to The VBAC Link to process my Cesarean due to breech presentation. It helped so much to hear women put into words all that I had thought and felt. Then I listened to it in preparation for my VBAC. Today, 8/7/22 and there were times I thought that my VBAC was slipping away but I was able to be prepared and get a little lucky and pushed out my 9-pound baby in 48 minutes with no tearing!” It says, “Thank you so much. Talk about the feeling of being superhuman. Thank you so much, Julie and Meagan.”I love that, superhuman. You are all superhumans. Birth is just so wild. Wouldn't you agree, Carlise? It is such a crazy experience but it is so amazing. It is so beautiful. It is crazy to think about how different births can be. Carlise: 100%. It's crazy. Meagan: Between one baby to another or say you have five babies and you're like, “Yeah, this has been the same.” I have a friend who has had her 5th baby. She was like, “Okay. I have had easy peasy births” and all of these things, and her 5th baby was a Cesarean. She was like, “That came out of left field.” It was a whole crazy thing. She was really sick and baby was really tangled in her cord. But yeah. It's wild. It's wild to think just how the unexpected can happen so I think it's so important to listen to stories just like the one that we are going to be sharing today and all of the stories on the podcast so you can get a better grasp and understanding of childbirth, how it looks, the interventions, and all of the things that can happen in childbirth. Sometimes it's really hard to listen to those Cesarean stories for sure because you're not wanting another Cesarean or if you're a first-time mom listening to the podcast which we do have first-time parents listening to the podcast, it's hard to want to listen to those because it's not what you're preparing for or it's not what you think would ever happen but like 90% of us on this podcast, we didn't think a Cesarean would happen either so it's so, so, so important for us to learn all of the ways birth can come at us. We are going to get to your story but I would love to know if you have anything that you would like to add in the beginning of advice to the parents listening. Carlise: I think just doing as much research as you can possibly do and know that you may have some pushback in getting your VBAC or the birth that you want in general. But be confident in that research and also share that with your spouse or your support. Let them know, “Hey, this can happen or these are choices that we might have to make,” so that everybody's educated and everybody goes in the room knowing what can happen because anything can prep for all of it but you've got it and it'll be fine. Meagan: Yeah. Yep. I love it.Carlise's StoriesMeagan: Okay. Well, we are going to get into this story but first, I just want to quickly introduce you a little bit more. We talked about how you are in Texas but you are from a small town in Missouri where you met your husband right after high school which is so awesome. You have been married for six years. You've lived in Alabama, Germany, and now Texas. You are a stay-at-home-mama providing stability for your girls. You have the two girls. What are their ages?Carlise: My oldest daughter is two and we just had Amelia last month so they are almost exactly two years apart. Meagan: Two years apart. That is so awesome. Your husband is an Active Duty Pilot?Carlise: Yes. He flies Apaches.Meagan: Yes. That's so awesome. That's really, really cool. I am so grateful to you for being with us today and I would love to turn the time over to you to share your VBAC story. Carlise: All right. My first pregnancy was super uncomplicated. There weren't any issues throughout the entire time. We actually got pregnant in Germany and then when we were PCSing or moving back to the States, I was 17 weeks. We didn't have any issues. Then we got to about 34 weeks and baby was breech. They were like, “No, no. It's good. It's good. Baby can flip, whatever.” I'm over here planning my vaginal birth, no problem. I have all this research done and then 35 weeks, still breech. 36 weeks, yep. Still breech. They gave me all of the things. ECV, moxibustion, Spinning Babies, and chiropractic care, but it was right in the middle of COVID so I couldn't do chiropractic care. I couldn't do acupuncture. I tried all of the things but she just wanted to be like a little taco. She was my little frank breech baby. We scheduled a C-section for 40 weeks. She wanted to come at 38+4 so we had gone in because I had a very, very slow leak. It was slow enough to where I was like, “Okay. Is this my water? Is it not my water?” Yeah. Sure enough. So when we got in, we had to wait a few hours because I had eaten that morning. We had a pretty uncomplicated C-section. The spinal took multiple different tries so that was horrible. The drain was at my collarbone so I didn't get skin-to-skin after. All of the medication just made me super foggy and I straight up don't remember the first two hours of my daughter's life. I don't remember latching her for the first time. It's still really rough because that's not the experience I wanted at all. Meagan: Right. Carlise: So when I got pregnant again 14 months later, honestly I walked into it a little naive because when I had done my research for my first pregnancy, I knew I wanted that vaginal birth. I had seen information on VBAC a lot actually when I was doing some of my research. I just kept seeing that it was a good thing. It was recommended by ACOG or whatever so I just thought that that was normal. Meagan: You didn't even question it. You're like, “Okay, great.”Carlise: I didn't even think about it. When I was trying to make my appointment on post because we have Tricare Prime and you have to be seen on post. They were like, “Yeah, no. We can't get you in until you're 17 weeks pregnant.” I was like, “No. That's not going to work.” They pushed me into the network off post and that's actually kind of what I wanted but little did I know, the military hospital is the most VBAC friendly. I didn't know that at the time. I had chosen an OB that everybody was like, “He's great. He's so good.” I was like, “Awesome.” At my first appointment with him, he sounded so supportive. He was like, “Yeah. You sound like a really good candidate.” He looked at my OP report. I was feeling really good about it. Then every consecutive appointment with him, I think I had three legit appointments, he just kept saying, “C-section this. C-section that. Whenever you want to schedule a C-section–” and I'm like, “Yeah. I have a sneaking suspicion that this is going to be a bait and switch here.” Meagan: Which is a terrible feeling. It's not a fun feeling when you're like, “Why is everything switching?” Carlise: Especially when he sounded so supportive, it was so disappointing, and then having to switch at 20 weeks, you're like, “Okay, great.” Then, the anatomy scan that he did was literally less than five minutes. We both know that is not an anatomy scan. He pointed out major features. He didn't look at the spine. He didn't look at the heart. He didn't look at any of these things. I was just feeling so uncomfortable with my care so I was like, “Yeah, no. I think I'm going to be done.” I was interviewing doulas and my doula had asked where this doctor delivered. I told her. The two hospitals that he delivers at have the highest rate of C-sections in the area as well as really, really bad reputations for episiotomies. Hearing her stories from being a doula at those hospitals was not great. I was like, “Okay, yeah. No, I'm going to switch now.” I talked to her about where she recommended and she's like, “Honestly, on post. If you can get back on post, that's going to be the most recommended but if you can't,” which I wasn't able to, the university hospital was going to be the second best place to get the VBAC. I switched my care. My pregnancy was super uncomplicated again. At the university, I never saw the same doctor which I really didn't want but I was just like, “Whatever. I'm going to do this whether or not I have a supportive provider, so it's good. You're just here to give me prenatal care.” They were definitely more tolerant than fully supportive. They kept saying at every single appointment, “You're going to get an epidural, right? You're going to get an epidural.” I was like, “No.” They're like, “Okay, well it's just in case.” I hear that a lot.  But no, I'm planning on going unmedicated. They just kind of left it. Then we got to about 38 weeks and my doula had called me. She's like, “Hey, I just had a horrible experience at UMC. The nurses were really pushing back at everything that this first-time mom had wanted.” They didn't treat her well and it just sounded super, super iffy. She's like, “We can obviously still go. I just want you to be prepared that it might be something that we could encounter.” The whole time, I was like, “I just want to go to the military hospital.” I had my daughter there. I was really comfortable with the staff. I really liked their care. So I was like, “You know what? We're just going to go to the military hospital in labor.” She was like, “Okay, cool. Sounds good.” So that's what we ended up trying. One day before 40 weeks, I went into labor super early in the morning. It was 1:30 in the morning. They were very odd contractions. It was like a rollercoaster for 24 hours. They started at ten minutes apart and then six but they would bounce around. They weren't consistent at all. That just happened forever. I was just like, “I just want to be done.”Meagan: You're like, “I'm tired.” Carlise: I was so tired. I was trying all of the things like the Miles circuit and curb walking, playing with my daughter, and trying to rest. Nothing was working. My doula was like, “Do you think it's a mental block? Do you think there's something?” I was like, “No, I feel good. The TENS unit is amazing.” I baked a cake while I was in labor. I was just like, “I don't understand.” She's like, “You've got this. It's fine. It's going to progress. Just try to rest as much as you can.” Then it was at 40 weeks at 1:30 in the morning that we started progressing a lot quicker. I was at 6 centimeters and I was like, “Yeah, I'm going to call the doula.” My husband ended up calling and while he was on the phone with her, they were just getting really, really intense. He was like, “Yeah. I think we're ready for you to come.” She started making her way. It was about a 45-minute drive. At about halfway for her, she calls and she's like, “You know, Carli sounded like she was ready to go. Is she progressing?” Doug was like, “Yeah. It's getting serious.” She's like, “Okay. Let's just meet at the military hospital. Let's meet there. I'll meet you at the parking lot.” We go ahead and make our way over there. It's about a 15-minute drive so it's not too bad. She gets there at the exact same time that we do. The doula had also let the hospital know that we were on our way. They were already expecting us. When we got to the L&D, the nurses took me back. They did all of the normal blood pressure. They hooked me up to the monitors. They asked me why I had decided to go to the military hospital in labor. I gave them my whole explanation and they were like, “Yeah. Okay, sounds good.” They were super nice and very supportive. I had also taken all of my labs with me, the GBS strep results, and all of the things as well as printed out my post-OP report for them to have as quick and easy access. Meagan: Which as a side note is always good to have even if you're not planning on going to another hospital because you never know if a precipitous labor happens or anything but it's really nice and usually providers enjoy having that. It brings comfort. Carlise: Yes so that's why we brought it. They also had seen that I had been in triage two weeks before because my daughter wasn't moving as much. I decided to go there so that way they could check the baby and also have me in the system already. I had talked to a doctor as well about coming there in labor. They asked me all of the things like if I knew the risks and benefits of VBAC, just took some medical history, and were very supportive. They were like, “Yeah, absolutely. We don't mind you coming here in labor at all.” I felt so confident. I felt so confident going in. The nurses had been like, “Okay, cool. Sounds good. Are you wanting an epidural? Are you wanting an IV?” I was like, “No. I don't want an epidural. I just want a heplock. I've been able to keep down fluids and everything so I'm not having any issues with that. I just want a heplock.” They were like, “Cool.” So very supportive and nice nurses.They were like, “Okay. We're going to get your support.” They went and got my doula and my husband and then they did a cervical check. At this point, my contractions were three minutes apart and very consistent. When they checked me, I was at 4 centimeters, 90% effaced, and -1 station. Baby was still up there a little bit. They also noticed some decels on the monitor. I was on my back and I was so incredibly uncomfortable. My daughter did not want me on my back. Every time I was on my back, it was awful. We had asked the nurses if that was a possibility and they were like, “Yes, but you bought your ticket for admission because of those decels.” We're like, “Okay, no problem.” We were expecting to get admitted anyways. So then the nurses were like, “Okay, we're going to get the doctor but I want you to know that he's very military.” My husband, my doula, and I are looking at each other and we're like, “Hmm. That's a weird way to describe a doctor. Okay.”We were just expecting very blunt and very upfront. While we were waiting, I was just so uncomfortable so I got up beside the bed by the nurses' station and was just rocking. I was having a really hard time with my contractions at this point. My doula came up behind me and gave me hip compressions. Then the doctor comes in. He doesn't introduce himself. He's not like, “Hi, how are you guys doing?” Literally nothing. He goes over to the doula and just goes, “And who are you?” The doula introduces herself and he's just going on and on about how she's in the way. He's yelling at her like, “You're in my way. You can't be in my way. You can't be in front of medical equipment.” She's just helping me with a contraction so he's not even recognizing or caring at all that I'm having contractions and that I'm in pain and she's trying to help me. He's just more concerned that she's in the way. So then she moves beside the bed and he looks at her and goes, “After the exam, we're going to have a chat.” We're like, “What is with this dude? Why is he being so aggressive?” So then the first thing that he says to me again just in a very disrespectful tone is, “Why are you here?” I'm like, “What a weird question to ask someone in labor.” I was like, “I'm in labor.” He goes, “No. Why are you at this facility when none of your prenatal care has been here at all?” The nurse was trying to tell him because again, I'm having contractions pretty often but no. He wanted all of the answers from me. He was just being so aggressive and I told him the whole explanation that I had already told the nurses. I also mentioned, “You're being really, really combative. You're making me uncomfortable.” He's like, “You know, I'm not trying to. That's not my intention, but you need to understand the position that you're putting me and this hospital in by changing your care at 40 weeks.” I was like, “Okay. I'm sorry, but I'm already here.” He just goes on for 30 minutes about how we're putting him in a precarious position and we need to understand this. We need to understand that. We don't have your records. I was like, “Dude, I brought you all of my labs. I brought you my post-op. What else do you want? What else do you need?” Again, he just keeps going on and on. Eventually, my husband was just like, “Okay, man. What do you need from us? Do I need to go to the other hospital and get your records? Can you request the records or can we just move on because we are getting nowhere?” The doctor was just like, “You need to understand.” I was just like, “Dude, we get it. We understand.” After that, he was like, “Okay, well I need to see if you are intact” which is a very weird way to say that he needs to check my waters. For some reason, I just had the fog. I knew that it was a swab. My doula was like, “It's okay. It's just a swab. They're just going to swab you to see if your water broke. It's not a big deal.” The nurses are like, “We're pretty sure that her water hasn't broken yet.” He's like, “No. I need to check myself.” So they're prepping the swab and then my doula hears him ask the nurse for lubricant. I could have sworn that he said something about a speculum but I'm not sure about that. My doula was like, “Hey, Carli. Do you consent to a cervical exam?” I was like, “Wait, no. No, no. I do not consent. I just had one not even ten minutes ago. So, no.” So then the doctor starts yelling at the doula again and saying, “Stop. You don't give medical advice.” Then I'm having a contraction and he's accusing her of making medical decisions, of moving me before the doctor came in the room, but he didn't like that I was beside the bed standing up. He thought that she did that. So then after the contraction, I was like, “Dude, no. She's only acting on my behalf when I have asked her to do something. You really need to back off. No. I do not consent to a cervical exam.” So then he explains why he wants to do a medical exam. Meagan: Again, you had just had one not long ago. Carlise: Right, exactly. Meagan: A little backstory, guys. I was reading this story on social media and I remember when I was reading this, I was like, “Why? Why? Why?” Every time, in my head, I'm like, “Why do we need to do this? Why do we need to do this? They just did this.” I was putting myself in your situation. Carlise: It was so aggravating. The fact that he was prepping the cervical check without talking to me first. The doula had to mention it. You're like, “Okay, that's a super big red flag. Thank you for letting me know,” because if she wasn't there, my husband would have no idea. So he explains why he wants to do a cervical check again and I'm like, “No. I don't want a cervical check.” So then he goes and sits down, stops prepping any exam at all, and he's like, “I'm a really good doctor but I need to be able to do my job.” I'm like, “Dude. I already said that you could do the swab to check my water. I'm not refusing your care. I just don't want a cervical exam.” He's like, “No. You're refusing my care. I have to do both in order to–”Meagan: Make an assessment. Carlise: Make a decision. I was like, “Okay. I'm really uncomfortable with your insistence here. I want a new doctor. You're not listening to me. You don't seem to care that I'm having contractions every three minutes. I want a new doctor.” He goes, “There isn't one.” I'm like, “What?” He's like, “Yeah. I'm it.” So then the doula was like, “Okay. There has to be somebody on call. Can you go ahead and call them in?” So then he says, “Stop” again to her and says, “I do not engage with you.” I was like, “Okay. I'm going to repeat the question. Can you call the person who's on call please?” He was like, “No, there isn't anybody on call. It's just me. The next provider doesn't get in until 8:00 AM.” At this point, it's around 4:00ish. I was like, “Okay. Can I just labor with the nurses? Because you're not touching me.” Meagan: And the nurses were being so great. Carlise: They kept trying to interject and answer questions for me but he wanted the answers from me. At that point, I was like, “Okay, dude. Just get out. Everybody needs to leave. I need to talk to my doula and my husband.” They go ahead and leave. I'm like, “Okay. I don't know what to do.” I'm freaking out. My doula was like, “It's okay. You're fine. We can stay here and deal with this dude. We can go ahead and just leave and go home. Your contractions are probably going to slow down since we're dealing with this or we can go straight to the other hospital.” I was like, “Okay. Let's definitely just leave. I'm done.” We told him that we were leaving and he just seemed shocked. Meagan: I'm sure. Carlise: Just completely shocked. I was just like, “No. We're leaving.” So then they were like, “You have to sign out AMA then.” I was like, “Cool. I'll go ahead and do that. You're not touching me.” We went ahead and signed the paper. As we were walking out, I'm having to stop every minute. The doula is like, “Okay. Yeah. We've got to go straight to the hospital.” We ended up, and in mind fog, I was like, “I forgot my birth plan so we're going to run home real fast. I'm going to get my birth plan.” That turned into an F-1 pitstop because I'm over here with really, really low sounding and having a rough time. Doug, my husband, is also freaking out. He's like, “We're going to have a car baby.” Meagan: Oh yeah, I'm sure. Carlise: He's just panicking. So he's speeding on the way to the other hospital. We get there and I had never gone through that entrance before. I had always gone in a different one on the back because my prenatal care was with Texas Tech and UMC, they're right next to each other. So I always went into a different entrance. So the entrance that we went into, I had no idea where to go. I'm over here. I swear I'm about to push and we don't know where to go. This super nice lady who was coming into work was like, “Do you guys need a wheelchair?” Doug was going to say no! I'm like, “Yes. Yes, I do.” So she gets a wheelchair. She brings us up to triage. As soon as we get up there and there was a trash can right next to the elevator. I'm just throwing up right next to the elevator. They're trying to get Doug to fill out paperwork and have me sign things. I'm just kind of dying. Then I needed to go to the bathroom. I didn't need to push. I just needed to go to the bathroom. I go in there and my water breaks. My plug comes out. So then I'm just gripping the walls. I'm just blinded here by my contractions. So they get me into a triage bed and they're like, “Oh yeah. Yep. Mhmm. She is ready to go. She is fully dilated. Baby is definitely ready.” The doula is over here like, “Okay, yeah. We need to switch her bed too.” So they switched me into a labor and delivery room. She's calling all of the shots here because the lights were so bright. I'm over here like, “Oh man.” So she's like, “Okay, those lights need to be dimmed. We need to take this gown off of her.” She was taking off my TENS unit. They're trying to put on monitors and I'm promptly trying to take them off so just being very unhelpful which I did not care about. So then they were trying to get the monitor on to check the baby. I was on my hands and knees which they did not want me on. I did not care. The doula is trying to help so she had reclined the bed so that I could lean over it so that way they could get the monitors on. That actually ended up working super, super well. Then I was feeling the need to push. Then I was just really self-conscious because I was feeling like I needed to poop. I was just like, “Oh no. This is horrible.” She's like, “No, that's normal. It's fine.” I was like, “No, I actually think I need to go.” So she's like, “It's fine. They're going to catch it. Don't even worry about it. Just focus on the baby right now. You're okay.” She snapped me out of it. I was like, “Okay, we've got this.”I was pushing and they were like, “No, no, no, no. The doctor's not in. Don't push. Don't push yet.” I was like, “I'm not not pushing so y'all need to figure it out.” So then the doula's over here like, “She's crowning. Baby's crowning right now.” Then they're just rushing in and I could feel the ring of fire. I was like, “Okay. I need to pause for just a minute,” because I could feel if I kept going that I was going to tear up. I honestly loved that I could feel that versus having an epidural and not being able to feel that. Within another couple of pushes, baby was out and I didn't have any tearing. I didn't have any issues at all whatsoever. I did not get the Pitocin for the delivery of the placenta and I didn't have the IV. I didn't have anything, just honestly the most natural birth except for the hospital situation. Meagan: Yeah, yeah. But no interventions other than maybe a cervical exam here and there. Carlise: Exactly. It went super well honestly overall and I was so proud of myself because I was just like, “I did that and I was able to advocate for myself.” My doula was amazing. My husband was very supportive even though he was freaking out. Meagan: Oh I'm sure. Yeah. Carlise: He told his dad. He's like, “It was super, super intense. The last couple of pushes, she sounded like a banshee and then baby was out.” I was like, “Wow, babe. Thank you. Thanks. That's super sweet of you.” The nurses afterward kept coming in and they were like, “Okay, we need to drain your IV and we need to check your stitches.” I'm over here like, “No guys, I don't have any of that.” They're like, “Wow, okay. You're the easy patient.” That birth, I was able to feel her before she came out. That was amazing. She got right on my chest. Delivering the placenta was super easy. I love that I can remember it and I'm proud of myself. The first thing that I said after birth was very colorful which definitely included, “F that doctor” which we then had to be like, “No, no. Not you, ma'am. Sorry.”Meagan: Yeah, yeah. I can relate to that one because that's what I said. I said, “Screw you,” and then I named the doctor. Take that. Carlise: Mhmm. I was just amazed and then everybody that I tell when I'm like, “Yeah. I left the hospital at one-minute contractions,” and they're like, “Oh, no.” I was like, “Yeah, no. I would rather have had a car baby legitimately–”Meagan: –than to go there. Carlise: Absolutely not. I was so disappointed and the fact is that's what we encountered. We put in all of the complaints that we could possibly put in and I'm still waiting on the head of OB to contact me but the doula had a really, really good meeting actually with the head of OB, a lot of the staff, the provost marshall apparently was in there as well. Meagan: Wow. How did she connect? How did she go about doing that? Carlise: Apparently, with doulas, there is a different system for them. I'm not entirely sure but there are different routes that they can go because they are professional birth workers. She had contacted the head of OB and then the head of OB was like, “Okay, this is really serious.” So I think they just coordinated together. The end of that resulted in a giant meeting with all of the OBs to basically educate them on what to do when a doula comes in. Meagan: Oh wow!Carlise: And that doctor that we encountered has to go to those meetings. My doula's teaching it. It's a class. I was like, “Yeah man. You're going to deal with that.” Meagan: That's actually really cool to help that space be a little bit more collaborative because I feel like we are a little spoiled here in Utah. People are like, “How do the doctors treat you and handle things when you are in there?” Usually nine times out of ten, it's very friendly and it's not hostile like that but if it were, I think that we would probably want to be doing something like that as well and say, “Hey, we are all here for this patient. We are all one team here. We're not here to be combative and create trauma emotionally.” That's really cool. That's really awesome. Good for your doula. Carlise: Yeah. I was so proud of her, especially being yelled at by a doctor. Meagan: Yeah. Yeah. Carlise: She's trying to advocate for me as much as she can but she also doesn't want security called on her so she was having to find a balance between that. Meagan: And she doesn't want to make it any worse for you. Carlise: Exactly. That was super, super odd. The fact that I meant to mention it in my story, but he had been quizzing me over VBAC facts, then he was telling me that I was wrong. I was just like, “What?” and just freaking out. She just helped me so much. I'm a huge advocate for doulas and having one and I 100% recommend anybody to have one for sure. My husband would have had just no idea exactly how to advocate for me in the way that my doula had. It was great. Meagan: Yeah. Yeah. I feel like there are so many benefits of doulas but just like we were saying, she helped him too. She helped him through this process I'm sure to feel more comfortable and at ease with the things that were taking place. Even that alone whether you had a lot of help with counterpressure and stuff like that but being able to have a sounding board and someone there that you feel is on your team and it's not you two against one person. I'm sure that brought so much comfort to him. Carlise: 100%. The fact that the doula had also done some childbirth education with him so that he knew how baby comes out and the different stages as well. Meagan: Yes and then when you have a provider questioning the facts around VBAC and you're saying this and then they're saying no or they're shutting you down or they're giving you false percentages which I know is a thing, that can be really, really scary if a partner is not educated or doesn't know ahead of time. So that's another really great pro of doulas is that they usually meet with you before, counsel, and go over all of those stats. I remember the feeling. I literally was on the treadmill walking, trying to pass the time because I hate the treadmill, reading your story and I'm like, “Oh my gosh. This is just so intense. It's so intense.” Carlise: It was nuts. When I was trying to prep my husband for the VBAC, I'm pretty sure he just got really annoyed by me listening to this podcast all of the time. I'd be like, “Babe, you should have heard this from this mom.” He's just like, “Ugh, I can't wait until you've had the baby because I'm so done hearing about all of these VBACs all of the time and all of these stories.” But then honestly, it prepared him. I was like, “Babe, this can happen,” so when we were facing this doctor, he wasn't second-guessing me at all. When I told the doctor the different things that I knew about VBAC because he wanted to make sure that I knew, Doug was like, “No. She definitely knows the stuff. She could spout this off normally.” He was confident. That made me more confident and with my doula being there, it helped a lot. Meagan: That makes me smile. I love it. Now you can be like, “Yeah, now I'm one of those people on the podcast.” Carlise: Mhmm, yeah. He was like, “I get to hear this story for the 35th time.” Meagan: I love it. Carlise: I was like, “Last time, babe. Last time.” Meagan: Last time. Maybe, maybe not. You'll be sharing it for years. You'll be sharing it for years. Carlise: Exactly. Meagan: Well I want to talk a little bit about the AMA, the Against Medical Advice form. It is one that like I said, maybe I'm crazy. It might have been a year ago actually that we talked about. It's not one that happens often or that people maybe even know exists. I just want to give a little side note. It's not something I suggest always doing like, “I'm just going to sign this AMA.” Against Medical Advice forms are taken pretty seriously but when you are in a combative, hostile environment, an AMA may be something that can get you out of that experience. I, as a doula, was at a birth where a mom chose to sign an AMA. From a doula's standpoint, it was really interesting. I was like, “I would have totally done that too as a mom.” We were very much in labor. It was very clear that we were in labor but the toco, the monitor, wasn't picking up the contractions. This doctor comes in very rudely and says, “You're not even contracting. I don't even understand why you're here.” She looks at me and her husband. She's like, “I'm contracting, right?” We're like, “Yeah, you're contracting. You're doing really great.” They're like, “We're probably just going to send you home anyways so we can just sit here and wait,” and just was very rude, questioning her, and pretty much saying that she was not even in labor and that she was over the top. Carlise: Oh, lovely. Meagan: This one doctor that came in was like, “You are just highly sensitive and being overdramatic. Maybe you should learn how to cope better because you're not even contracting yet,” and just talking down and being very rude. She's vomiting. She's shaking. She is clearly laboring. They leave and she turns to us and says, “What other hospital takes my insurance?” As a doula, I wasn't expecting that but at the same time, I should have expected that because of how rude they were to her. I said, “Well, this hospital and this hospital.” She rips out her IV because they had given her an IV for fluids for vomiting. She ripped it off, was holding her arm, and was like, “Let's go!”Carlise: That's intense. Meagan: I was like, “What?!” She was literally holding her arm and she was like, “I am done.” Her husband was like, “Me too.” They were getting her dressed and as a doula, I'm like, “Okay. I go where you go.” Carlise: Man, all right. We're doing this now. Okay. Meagan: She's walking out and they're like, “What are you doing? What are you doing?” They're freaking out and she's like, “I'm leaving. I am going somewhere else to have my baby. You said that you were going to send me home anyways so I am going home.” They were like, “We'll have to have you sign an AMA.” She was like, “Where do I sign?” They were like, “Oh, but your insurance won't cover this.” Carlise: Mhmm, yeah. Okay. Meagan: She was like, “I don't care. I'm signing this AMA.” We went. We were 6.5-7 centimeters when we got to the hospital and had a baby a couple of hours later. Dad caught the baby. It was a beautiful, beautiful experience. So AMA, what does that mean? It's really leaving the hospital without the physician's advice before they decide to discharge you. It says right here in a NCBI which we will make sure that this is in the show notes today if you want to read a little bit more. But it says, “Leaving a hospital against a physician's advice may expose the patient to risk of an inadequately treated medical problem and result in the need for readmission.” That is important to remember, that we as parents know that. We are signing this form and we are saying, “We assume the risk of us leaving because we are leaving against your advice,” but I also think it's important for us to know and follow our mom's gut to be like, “I'm just going to have this baby and do this.”Carlise: 100%. Meagan: You have to think about it. If you are in an AMA situation, you want to really think about it. You want to weigh out the pros and cons and you want to be educated. If you're listening to this podcast, you're definitely starting your education because as you mentioned, you learn along all of these stories. But it's a big thing. The article says, “The problem with AMA discharge is the prevalence of risk and costs. It can formulate recommendations of managing and preventing them on the basis of available evidence.” That's so hard because they can say, “Well, this happened because you left,” or even the cost of insurance. They can say, “Oh, well we won't do this because you left against our advice.” So it's important to definitely learn more about an AMA and why you would sign an AMA but know that an AMA exists because if you are in a hostile environment, it's probably not a healthy one. Carlise: Right and that was my thing too. I didn't feel safe with this care provider and then being told, “No, there isn't another provider,” I feel like there are going to be so many more interventions and so many things that are going to be done without my consenting because obviously, they already tried to do that once. I would rather sign an AMA and leave than to have you touch me and cause issues that shouldn't have been caused at all. Meagan: Yeah. Yeah, exactly. I think it's important to know that it exists and then know the pros and cons. It's just one of those other things. Know the pros and cons of signing an AMA or what that entails and then having that backup plan. But just know that it exists because for the client of mine, she was like, “I couldn't have stayed there. I was feeling so anxious. I was feeling so triggered and traumatized by what they were doing and what they were saying to me.”She said, “The second I walked into this new hospital, I just truly felt 100% at ease. 100% at ease.” So yeah. It's so important to feel that comfort, know your options, and look at you. You did! You went and you had an unmedicated, no-intervention VBAC. Carlise: Yeah. Honestly, it's been amazing. The recovery has been fantastic and I am so proud of me and every mama who has had a VBAC and had to fight for it. That's just awesome. Meagan: You should be so proud of yourself. Congratulations. Thank you for coming on and sharing this story. I also want to end with a preface by saying that sharing this story is not to bash an OB or anything like that. Carlise: 100%. Meagan: It's not anything like that because OBs are great. I'm sure he was caught off guard. He had his stuff but at the same time very much acted in a very unprofessional way. Carlise: Absolutely. Meagan: It's important to know all sides of things. Carlise: 100%. Absolutely. ClosingWould you like to be a guest on the podcast? Tell us about your experience at thevbaclink.com/share. For more information on all things VBAC including online and in-person VBAC classes, The VBAC Link blog, and Meagan's bio, head over to thevbaclink.com. Congratulations on starting your journey of learning and discovery with The VBAC Link.Support this podcast at — https://redcircle.com/the-vbac-link/donationsAdvertising Inquiries: https://redcircle.com/brands

The Mystery of Your Mind

The Hippocampus is a small, yet complex, structure located deep within the Temporal Lobe and plays a critical role in our processing and storage of memory and learning process. In this fast-facts episode, Edward reviews the Hippocampus's form and function, as well as the key features that make us who we are.To create this episode, I used information provided by Anand and Dhikav, 2012 in the Annals of Indian Academy of Neurology through NCBI, which can be found here: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3548359/#:~:text=Hippocampus%20is%20a%20complex%20brain,of%20neurological%20and%20psychiatric%20disorders.No statement, phrase, or episode of this series—or any episode in this podcast—are intended to treat, diagnose, cure, prevent, or otherwise change your mind or body in any form or manner. This podcast—and this series especially—is meant purely for education purposes for the common person. Please do not rely on any of the information I share in this podcast in any way for your medical or psychological treatment. If you feel that you may have a condition mentioned or not mentioned in this podcast, do not come to me. Instead, immediately go to a trusted psychiatrist, psychologist, therapist, counselor, or other reliable source of information and help for further guidance. Never disregard professional, psychological, or medical advice—nor delay in the seeking of this advice—because of something that you have heard or read from this podcast, this podcast's episode descriptions, this podcast's promotional materials, or any other information explicitly or implicitly generated from this podcast.-----If you love this podcast, show your support by rating, subscribing, and downloading!  The best way to support me is by sharing this podcast with others—the more people can learn, the better we can understand the crazy world we live in :DI realize that this episode is coming back after a very long hiatus--I have had a few issues with my podcast server, but the rest of the episodes of this season will be published in the next few days :) Sorry for the delays and thank you for your patience!

Straight Talk MD: Health | Medicine | Healthcare Policy | Health Education | Anesthesiology
Exclusive: Secret gain-of-function research on novel coronavirus in Wuhan uncovered from mining genomic datasets with Steve Massey

Straight Talk MD: Health | Medicine | Healthcare Policy | Health Education | Anesthesiology

Play Episode Listen Later Mar 2, 2023 97:52


Last week, Adrian Jones, Daoyu Zhang, Steven Massey, Yuri Deigin, Louis Nemzer, and Steven Quay reported out on an ingenious analysis of genomic datasets from NCBI that indicate a lab in Wuhan was performing potentially risky genetic engineering manipulations on a novel coronavirus that was previously unreported. The manipulation? Inserting a MERS spike protein into a previously unreported coronavirus. MERS has a case fatality rate of over 30%. What is clear from the analysis is that at least one lab in Wuhan was performing risky gain-of-function research on unreported coronaviruses before the pandemic started, the kind that could have created SARS-CoV-2. It also shows that risky GOF research is being conducted in Wuhan that has no identifiable medical benefit, but has the potential to create a pandemic level pathogen. Today I interview Steven Massey, a professor of bioinformatics that has been actively researching the origin of SARS-CoV-2 since the pandemic began and one of the authors of this significant discovery. We discuss the paper, how his team discovered this novel engineered coronavirus from Wuhan, and what it means in the search for the origin of COVID-19...

Brendan O'Connor
Newspaper Panel

Brendan O'Connor

Play Episode Listen Later Nov 27, 2022 51:35


Lorcan Sirr of TU Dublin, Suzanne Lynch of Politico in Brussels, IIEA economist Dan O'Brien and NCBI's Lorna Fitzpatrick go through the Sunday papers with Brendan

Blind Guys Chat
#057: Hashtag Give it a bash!

Blind Guys Chat

Play Episode Listen Later Nov 16, 2022 62:14


It's time for your favourite podcast again folks. We have a small change to the starting panel as Stuart has gone to Germany searching for gas to heat his massive penthouse in the sleepy suburbs of Kathmandu. So, wearing one of Stuart's off the shoulder numbers is the wonderful Clodagh. Ooh la la…   We kick off this week with Jan and his new video doorbell. Yes, it appears Jan's wife is getting a bit sick and tired of Larry bursting through the front door for playtime with Sjef. So the Bloem household now features a First Security video doorbell which Jan thinks is the business. The great news is that it is not a subscription service but rather has an SD card for recording locally instead of on the cloud, like Ring doorbells. Check it out here: www.firstsecurityserviceinc.com/video-doorbell.html   Now that the security is sorted, it's time to move onto a great discussion on mental health. Clodagh is joined by Peter O'Toole, Head of Counselling, Wellbeing & Emotional Support with NCBI; Kathryn Sinnott, Senior Fundraising Executive and Insight Counselling Service Insight Groups Coordinator in Fighting Blindness; and Ken Walsh, who is visually impaired and is a guide dog owner. The panel talk about how to recognise when you might benefit from some support with your mental health, what support groups are available, and the difference between counselling and support groups, and much more besides.   We have compiled a list of supports available from Fighting Blindness and NCBI which you can access here: tinyurl.com/BGCsupports. We will add to this list as time goes on. If you would like to add information about these kinds of services from your country, please send the info to blindguyschat@gmail.com.   So, throw caution to the wind, throw frisbees to the dog, and settle in for the number 1 podcast as voted by COP27 delegates: Blind Guys Chat. 27 out of 27 attendees prefer it to overpriced sandwiches and desalinated water. Support Blind Guys Chat by contributing to their tip jar: https://tips.pinecast.com/jar/blind-guys-chat

United States of Murder
Wacky Wednesday 5

United States of Murder

Play Episode Listen Later Nov 2, 2022 25:07


Each week we chat about a couple of wacky true crime cases that do NOT involve murder. Like true crime with a twist of comedy? Don't want to hear the dark and gory details? This one is for you. This week, we chat about an adult man pretending to need diapers and a grandmother who gives ouija boards as gifts at her own funeral. We also have a story about an Australian man eating a deadly slug on a dare. Then, we will share something strange that happened to us in the past week along with a listener's eerie story. We'd love to share some of your stories! Want to share something wacky? Email us at unitedstatesofmurder@gmail.com You may now join us on Patreon or buy us a Cocktail. Be sure to subscribe on Apple and leave a review. Follow us on Facebook, Instagram, and Twitter! Music by Pixabay Sources: Oxygen, Exploring Your Mind, NCBI, NY Post, Insider --- Support this podcast: https://anchor.fm/unitedstatesofmurder/support

Brendan O'Connor
Newspaper Panel

Brendan O'Connor

Play Episode Listen Later Sep 18, 2022 52:02


Brendan is joined by Ciara Phelan, Political Correspondent, Irish Examiner Lorna Fitzpatrick, Advocacy & Engagement Manager, NCBI and former President USI Ireland and member of Labour Party, Prof Alan Barrett, Economist & Director, ESRI and Declan Power, Defence Analyst and Writer.

The Nonlinear Library
LW - Sequencing Intro by jefftk

The Nonlinear Library

Play Episode Listen Later Aug 31, 2022 10:34


Welcome to The Nonlinear Library, where we use Text-to-Speech software to convert the best writing from the Rationalist and EA communities into audio. This is: Sequencing Intro, published by jefftk on August 29, 2022 on LessWrong. I've been working in computational bio for a couple months now and I've been learning a lot. There's still a ton I don't know, but I'm currently at a stage where I've put some pieces together while still remembering what it was like not to understand them, which is often a good time to try to write introductory stuff. Trying to explain things is also a good way of making sure I understand them myself. So, here's an dump of what I've been learning: The biological world primarily stores information with nucleic acids. These are series of nucleotides, often called bases: A, C, G, and T. For example, a strand of nucleotides could look like: The two main kinds of nucleic acid are DNA and RNA. They differ in a few ways, but from a computational perspective they're very similar. Physical RNA will have U instead of T, though in sequencing data you'll often see it with with T anyway. Each base has a complement: A bonds with T, and G with C. A nucleic acid that comprises two bonded strands is called double stranded. Each base in one strand will be bonded to its complement: CCGACTCTGTCACGGGTCTAGCAATGTGGTAAGCA This is the famous double helix and makes for a more stable structure than single stranded nucleic acid. Going from a physical nucleic acid to a sequence on a computer is sequencing, and the reverse is synthesis. I'm only going to talk about the former; I haven't learned much about the latter. The most common sequencing method today is Next Generation Sequencing, commonly called Illumina sequencing after the main vendor. Bases are dyed and the machine reads their colors. The output of sequencing is a large number of short reads. Each read is a sequence of 50-300 bases, usually around 150. In setting up the sequencing run you choose how many bases to read, and different applications will make the most sense with different lengths. Accuracy drops off as you read farther along the strand. Note the lengths we're talking about are way less than the length of a full nucleic acid, which is generally at least thousands of bases. Not getting the full picture is a big downside of this kind of sequencing. Let's get some real data to play with. When people publish a paper that depends on sequencing they generally upload their raw data to the NIH's National Center for Biotechnology Information (NCBI). Here's a paper I've been looking at recently, which sequenced wastewater: RNA Viromics of Southern California Wastewater and Detection of SARS-CoV-2 Single-Nucleotide Variants. If you look down to the "Data availability" section, you'll see: Raw sequencing data have been deposited on the NCBI Sequence Read Archive under accession number PRJNA729801, and representative code can be found at. The GitHub link is helpful for getting metadata (what does each sample represent?) and understanding how they processed it (what tools did they use and how?), but for now we're looking for sequencing data. The accession number is "PRJNA729801", and while we could click through and download it from the NCBI, the user interface on the European mirror (European Nucleotide Archive) is much better. We go to their landing page and enter the accession number: This takes us to a page that describes the data: We want to sanity check the title to make sure we didn't end up with the wrong data set, and "Metatranscriptomic sequencing of Southern California wastewater" sounds about right. Scrolling down there are links: We could download all of this data, but it would be about 80GB compressed. For now, let's just download a single fastq.gz file, at ~150MB: SRR14530724_1.fastq.gz. These files are generally both very large and very repetitive, so they're a natural candidate for compression. The most common option is gzip, and that's what they've us...

Highlights from Moncrieff
Clear Our Paths Campaign

Highlights from Moncrieff

Play Episode Listen Later Aug 22, 2022 8:53


People with disabilities are often at the mercy of other people's consciousness of the physical world and the way we all move through it. An abled bodied person doesn't have to worry too much about a van on the footpath, on street dining, sandwich boards or even an untrimmed tree branch blocking their route, they can simply go around it. Those same obstacles are not as easy to navigate for the vision impaired. Tabitha Kenlon is an advocate for NCBI's campaign to #ClearOurPath and she joined Sean on the show...

Student Success Beyond Expectations
Student Success Beyond Expectations Podcast Episode 36: Don't Leave Blindness In The Dark

Student Success Beyond Expectations

Play Episode Listen Later Aug 16, 2022 32:13


Three percent of children younger than 18 are blind or visually impaired (CDC) and according to the NCBI approximately 500,000 children become blind annually. The CEO of Helen Keller National Center and Helen Keller Services for the Blind educates us on the importance of accessibility for this diverse population of individuals. Integrating the hearing and deaf worlds can be supported through school- aged students choosing ASL (American Sign Language) as their second language to study, employees considering a deaf and/or blind applicant as an employee, supporting the roles of job coaches within the workplace and approaching assessability proactively. Click the links, listen and share to learn more! About Sue Ruzenski: Sue Ruzenski is the CEO of Helen Keller Services, an organization that helps improve the lives of individuals who are blind, have low vision, or combined hearing and vision loss. Sue has had a 40-year tenure at Helen Keller National Center for DeafBlind Youths and Adults and worked with employees across the organization to implement innovative services to meet the identified priorities of the community. She is an Oscar-nominated producer and the 2021 recipient of the LIBN Diversity Award. Sue has recently been featured on Respect Ability, The New Yorker, Newsday and Fox 5 New York. New exciting news! We are on Feedspot's list of the Top Parenting Podcasts! blog.feedspot.com/parenting_podcasts/ MUSIC Look to Listen to Learn By Lisa Navarra & Maryann Buonaspina - www.amazon.com/dp/B074CLC98K/... Train My Brain By Lisa Navarra & Maryann Buonaspina - www.amazon.com/dp/B074CGR87B/... This podcast is presented by Lisa Navarra, Owner of Child Behavior Consulting, LLC. You Can Follow Us On: - www.facebook.com/ChildBehaviorConsulting - twitter.com/LNavarraCBC - www.linkedin.com/company/64563206/ - www.instagram.com/childbehaviorconsulting/ - www.youtube.com/channel/UCWwCxj-Aq469... - www.tiktok.com/@lisanavarraedu - www.tiktok.com/@studentsuccesspodcast - podcasts.apple.com/us/podcast... - open.spotify.com/show/60vi5zx... - music.amazon.com/podcasts/16365f2…ond-expectations

Highlights from Moncrieff
"Technology is the biggest enabler for people with site loss."

Highlights from Moncrieff

Play Episode Listen Later Jul 19, 2022 4:10


The National Council for the Blind of Ireland is now using pioneering technology to allow its service users to access information, newspapers, books and more. Kyran O'Mahoney, Chief Technology Officer with the NCBI, joined Sean to discuss how technology can assist those with sight loss.

Sucias are my Favorite
The Ted Talk

Sucias are my Favorite

Play Episode Listen Later Jun 13, 2022 14:54


No, you didn't miss me on a Ted Talk. But, if I were invited, this episode would be my talk The data that I refer to comes from a national study by NCBI - national Center for Biotechnology Info, under US National Library of Information, under US Dept Health & Human Servs Fortunately the data has been extrapolated for easier reading by Huff Post and, Insider.com

Maximal Being Fitness Nutrition and Guthealth
Monolaurin's Applications Today with Maximal Being and Damon Sununtnasuk | Part 2, Podcast 55

Maximal Being Fitness Nutrition and Guthealth

Play Episode Listen Later May 23, 2022 26:25 Transcription Available


Joining us today at Maximal Being Fitness, Nutrition, and Gut Health, is Damon Sununtnasuk, CEO of Natural Cure Labs LLC. We will be exploring how Damon's company explored the application of lauric acid and monolaurin on various pathogens and applied the research to make an accessible, quality driven, research based supplement company that can really help people.Doc Mok an advanced GI doctor specializing in nutrition, gut health, and cancer. Joining him is the podcast's layman, Jacky P, smashing the broscience on this week's podcast. Their guest Damon Sununtnasuk serves as the Chief Executive Officer of Natural Cure Labs LLC, operating as Palmara Health and VitaTails brand supplements. If you enjoy the podcast, would you please consider leaving a short review on Apple Podcasts/iTunes? It takes less than 60 seconds, and it really makes a differenceReach out to us at team@maximalbeing.comOr https://www.maximalbeing.com/site/contactFREE STUFF3 NUTRITION HACKS (that Your Doctor Won't Tell You) FREE e-book: https://www.maximalbeing.com/3-nutrition-hacksThe Perfect Human Diet: A FREE 5 part training video: https://www.maximalbeing.com/the-perfect-human-dietWE CAN HELP YOUSign-up for our Kombucha Course: https://www.maximalbeing.com/kombuchaThe Meal Prep Bootcamp Course: https://www.maximalbeing.com/offers/oGLXwoof/checkoutNeed a Sustainable Nutrition Solution for Gut Health: https://www.maximalbeing.com/sustainable-nutrition-solutionOur sponsorsEmerson Ecologics (10% OFF All Supplements): https://wellevate.me/maximal-beingiHerb supplement BDB5528 and receive 10% off your orders: https://www.maximalbeing.com/iherbDiscount and website links:https://www.naturalcurelabs.com/discount/MAXIMALBEING (10% off discount embedded)https://www.naturalcurelabs.com/products/?ref=MAXIMALBEING (referral link)https://www.palmarahealth.com/ (or https://www.naturalcurelabs.com/)https://www.instagram.com/naturalcurelabs/Resourceshttps://www.maximalbeing.comhttps://www.monolaurinandmore.com/https://pubmed.ncbi.nlm.nih.gov/https://scholar.google.com/SocialFacebook: https://www.facebook.com/maximalbeing/Twitter: https://twitter.com/maximalbeingInstagram: https://www.instagram.com/maximalbeings/Pinterest: https://www.pinterest.com/maximalbeing/Linked'in: https://www.linkedin.com/in/maximal-being-13a5051a1/YouTube: https://www.youtube.com/channel/UCi7KVUF8U-gfhOE1KSNSupport the show

Maximal Being Fitness Nutrition and Guthealth
Introduction to Monolaurin with Maximal Being and Damon Sununtnasuk | Part 1, Podcast 55

Maximal Being Fitness Nutrition and Guthealth

Play Episode Listen Later May 9, 2022 18:56


Joining us today at Maximal Being Fitness, Nutrition, and Gut Health, is Damon Sununtnasuk, CEO of Natural Cure Labs LLC. We will be exploring how Damon's company explored the application of lauric acid and monolaurin on various pathogens and applied the research to make an accessible, quality driven, research based supplement company that can really help people.Doc Mok an advanced GI doctor specializing in nutrition, gut health, and cancer. Joining him is the podcast's layman, Jacky P, smashing the broscience on this week's podcast. Their guest Damon Sununtnasuk serves as the Chief Executive Officer of Natural Cure Labs LLC, operating as Palmara Health and VitaTails brand supplements.  If you enjoy the podcast, would you please consider leaving a short review on Apple Podcasts/iTunes? It takes less than 60 seconds, and it really makes a differenceReach out to us at team@maximalbeing.comOr https://www.maximalbeing.com/site/contactFREE STUFF3 NUTRITION HACKS (that Your Doctor Won't Tell You) FREE e-book: https://www.maximalbeing.com/3-nutrition-hacksThe Perfect Human Diet: A FREE 5 part training video: https://www.maximalbeing.com/the-perfect-human-dietWE CAN HELP YOUSign-up for our Kombucha Course: https://www.maximalbeing.com/kombuchaThe Meal Prep Bootcamp Course: https://www.maximalbeing.com/offers/oGLXwoof/checkoutNeed a Sustainable Nutrition Solution for Gut Health: https://www.maximalbeing.com/sustainable-nutrition-solutionOur sponsorsEmerson Ecologics (10% OFF All Supplements): https://wellevate.me/maximal-beingiHerb supplement BDB5528 and receive 10% off your orders: https://www.maximalbeing.com/iherbDiscount and website links:https://www.naturalcurelabs.com/discount/MAXIMALBEING (10% off discount embedded)https://www.naturalcurelabs.com/products/?ref=MAXIMALBEING (referral link)https://www.palmarahealth.com/ (or https://www.naturalcurelabs.com/)https://www.instagram.com/naturalcurelabs/Resourceshttps://www.maximalbeing.comhttps://www.monolaurinandmore.com/https://pubmed.ncbi.nlm.nih.gov/https://scholar.google.com/SocialFacebook: https://www.facebook.com/maximalbeing/Twitter: https://twitter.com/maximalbeingInstagram: https://www.instagram.com/maximalbeings/Pinterest: https://www.pinterest.com/maximalbeing/Linked'in: https://www.linkedin.com/in/maximal-being-13a5051a1/YouTube: https://www.youtube.com/channel/UCi7KVUF8U-gfhOE1KSNAqSupport the show

RTÉ - Liveline
Vulnerable daughter traumatised - Car fire - Anti-social behaviour - NCBI re-branding - Rats in house - Royal memorabilia - Wedding outfit

RTÉ - Liveline

Play Episode Listen Later May 5, 2022 70:15


Trauma is driving Stephanie's vulnerable daughter into herself; Derek's car burst into flames on the motorway; Tony also lives on Long Lane which is being targetted by vandals; Karen opposes the NCBI re-brand; Anne's house infested by rats; the appeal of vintage phone boxes; an update on Letitia's lost wedding outfit

RTÉ - Liveline
Russians in Ireland mark Victory Day - Animal cruelty - Drug trial volunteer - NCBI re-branding

RTÉ - Liveline

Play Episode Listen Later May 3, 2022 69:46


Should Russian people in Ireland cancel a planned rally in the Phoenix Park this weekend?; Ilona was horrified to discover the cruelty inflicted on Norbert, their pet cat; Tommy was on a drug trial but he must spend €600 a month to stay on the medication; Visually-impaired listeners who don't think the NCBI should change their name to Sight Ireland

POOG with Kate Berlant and Jacqueline Novak

Micro-dosing psilocybin despite the insufferable overtones. Probiotics but not just any Yoplait strain. JN did the research on NCBI. Sub-perceptual benefits don't sell. Butterflies in the stomach, preserving energy, and anti-climactic repulsion. Bats in the hotel room and the Tetanus man. The Camelback and Drunk Elephant BabyFacial. Motility. . . . . . This episode was edited and engineered by C. Tweedie. See omnystudio.com/listener for privacy information.

Limitless
S1, E4: 5 Ways to Build Resilience in Your Business

Limitless

Play Episode Listen Later Mar 29, 2022 42:03


You deal with challenges every day, no matter where or who you are. If you're an entrepreneur, your mental state will define where your company goes — and that applies to any enterprise. This is why resilience is crucial for everyone. But here's the good news: you can build resilience to show up as your best self anywhere you go. In this episode of The Limitless Podcast, Jamie Ratterman shares five keys to building long-term resilience in business. More specifically, she delves into the importance of health, embracing failures, the power of self-reflection, the significance of a sustainable business ecosystem, and celebrating the present. Listen as Jamie explains the value of resilience in building your best self and, from there, your business! If you want to learn practical ways to build long-term resilience in your business, this episode is for you! Take a step toward business resilience with my 6-week program Social Expansion. This is all about sweating less about the algorithm and creating a potent leadership presence across the internet in less than an 1 hour each week. Learn more here: https://www.jamieratermann.com/social-expansion/social-expansion Here are three reasons why you should listen to this episode: Understand the role of resilience in showing up as your best self Discover ways to train your brain for long-term resilience.  Learn the five keys to building success for your business. Resources Break free from Instagram dependence with Jamie's Social Expansion 6-week group course! Read about the effects of 20 minutes of exercise on your brainpower in this NCBI paper! Episode Highlights [03:30] Resilience in Success  “Success does not come from continuously winning. Success comes from challenges, comes from figuring out that things aren't working exactly how you want, finding yourself getting stuck sometimes, but also, of course, celebrating those big wins” Resilience is essential to growing a successful business.  Be aware and accept the things that are holding you back.  Embrace the process and learn to bounce back and overcome adversities.  Learn to celebrate the present. This includes sitting with and showing up on the hard days.  [05:46] Your Best Self Is Your Business's Biggest Asset You are your business's lifeblood and life force. You are your business's biggest asset.  It is a must to take care of your mind, body, and spirit. By doing so, you can be your best self. Resilience is actively seeking and dismantling patterns that slow you down, creating new systems, and adjusting your mindsets accordingly.  [06:32] #1: Prioritize Your Health “You are going to get your best creativity, your best energy, and your best problem solving when you take care of your body first.” Your brain is affected by your routines, like your diet and sleep. Resilience comes from within. This is why it is crucial to prioritize your health.  It only takes 10 minutes of movement to change your day.  Take breaks to recharge! You can't be your best self if you're exhausted. [09:22] Incorporating Movement Daily  You do not need an hour-long workout to reap the benefits of your mind. A study has found that it can only take as little as 5 to 20 minutes of movement a day to get your brain working at its best.  You can use the Pomodoro Technique to create breaks during your day. Take a stroll or dance in your living room.  Think about how you plan and execute movement throughout the day. Overextending and overworking yourself can have detrimental effects.  Take breaks. Like a muscle, you can't be using your mind continuously. It needs rest too. [14:28] #2 Think of Failure as a Key to Success Challenges and failures are a part of the road to success. No one can relate to someone who's never struggled. Acknowledge problems but do not dwell on them. Show up and be solution-oriented instead.  The Scarcity vs. Abundance Paradigm: we are neither abundant nor scarce all the time. Our focus should be on finding ways to activate ourselves during scarcity.  Be mindful of your mind and body's current state. Ask yourself, "Why am I feeling scarcity?" Then pull yourself out of it.  “The more we talk to ourselves in a positive way, the more we're going to be able to flip that script a little more easily.” [19:59] #3: Embrace the Power of Regular Self-Reflection Review where you spend your time and energy regularly. Self-reflection is how you build resilience in the long term. Self-trust comes from having a more profound inner knowing of who you are. Cultivate a resilience mindset. What does your best self look like?  Reflect on your life so you can address issues you encounter.  Ask yourself, “Where do I feel stuck right now?” Then, try to find an activating step to alleviate your dilemma.  You are the energy of your business, and you want to preserve that. Don't neglect your mental health for your business! [24:40] #4: Creating an Ironclad Structure for your Business Step 1: Do not be dependent on a single channel. Instead, choose your channels and make sure they represent you well. Remember that you are creating an empire of what you do.  You do not have to have a website to start a business. But you have to have one to scale a business.  Step 2: Be inclusive in treating your email subscribers. Make them feel like they are part of an inner circle.  Step 3: Maximize your social media for brand awareness and conversion. Create a structure — an ecosystem for your business — where you allow yourself to be independent and not hold on tightly to one platform.  [31:56] #5: Celebrating Yourself and Savoring Celebrations People are always on the lookout for the next thing and very seldom in the present. We are often only present when in pain.  Celebration is about presence. It's about honoring all the work you've done.  We do not only celebrate big wins. It can be as simple as getting through a workout or getting a fantastic cup of coffee in the morning.  “All of these are wins. All of these tell us and our subconscious that we can keep winning. We can keep celebrating. We're not going to just continue to move into the next stress, the next thing we have to do.” Write down five gratitudes every single day. It gives you a better appreciation of now.  Find people you are ready to celebrate with and will make you want to continue to move. [39:25] Jamie's Social Expansion Program The six-week program will start this April and is invaluable for online business owners. Free yourself from Instagram dependence, accelerate your community and revenue growth, and build long-term resilience for your business, among others. Take a step toward business resilience with my 6-week program Social Expansion. This is all about sweating less about the algorithm and creating a potent leadership presence across the internet in less than an 1 hour each week. Learn more and sign up here!  About Jamie Jamie Ratterson is a holistic business coach and the CEO of her business, Jamie Ratermann Coaching & Consulting. The firm provides 1:1 and group coaching for entrepreneurs and companies and other services, including strategizing and curating social media content, building a brand identity and content plans, cultivating key partnerships, and providing data analysis and reporting.  Before starting her brand, Jamie had over ten years of experience helping entrepreneurs master marketing, embody leadership, and end the hustle. She has also led the digital presence of Blue Circle Leadership, TripAdvisor, Bonnie St. John, Uplift Studios, Financial Gym, and others. Want to learn more about my work? Check out my website. Come say hi on the 'gram. Have questions about my coaching or takeaways from the episode: DM me @JamieRatermann! You can also connect with her on Instagram and LinkedIn.      Enjoyed this Podcast on Creating Limitless Belief in Ourselves? If you enjoyed this episode, subscribe and help us spread the word by sharing it! Leave a review and share it! If you enjoyed tuning in to this podcast, we'd appreciate it if you wrote us a review. You can also share it to help other entrepreneurs break free from limiting beliefs and grow from them.  Have any questions or want to leave a suggestion? Come say hi on the 'gram @jamieratermann or contact me on my website! Also, you can connect with me on Twitter, @jamieratermann, and Linkedin: Jamie Ratermann. Thanks for listening! Stay tuned to my website for more episode updates and other exciting programs and resources.

Shelter in Place
Fixing the World in 10 Easy Steps

Shelter in Place

Play Episode Listen Later Mar 3, 2022 31:59


The world has always needed fixing. Some weeks it just feels more broken than others. This week, we turn to an unlikely authority to remind us of the things that can help us no matter what state the world is in. Want to support this work?  Make a monthly or one-time donation on Glow Leave us a rating or review on Apple Podcasts, Podchaser, or Spotify. Sign up for our newsletter. Complete show notes at www.shelterinplacepodcast.org @shelterinplacepodcast on IG and FB @PodcastShelter on Twitter Show notes: World Health Organization's guide to washing hands. NCBI history of handwashing. NIH article on the health benefits of play Learn more about Comic Relief's Red Nose Day. Jazz singer and songwriter Suzanna Smith  Kenny Washington, jazz singer and saxophonist Prior episodes mentioned today: The Lotus Eaters, Productivity Unhacked, Dancing Saved My Life, and Finding the Fuego.

Dying Kindness
18: Choosing Who Will Defend Your Wishes

Dying Kindness

Play Episode Listen Later Mar 2, 2022 22:19


Selecting the right Health Care Agent is a critical factor in ensuring that we get the kind of care we want when we're critically injured or nearing the end of our lives. Your agent will be responsible for implementing your Advance Healthcare Directive, and (even more) for understanding why you made the decisions you made so they can respond to unanticipated situations. How do you choose the right person? What, exactly, would you be asking them to do?   Referenced:  Review of studies on racial bias in pain perception in NCBI: https://pubmed.ncbi.nlm.nih.gov/17187552/

2 View: Emergency Medicine PAs & NPs
14 - Urticaria, Foreign Bodies, and a Special Interview

2 View: Emergency Medicine PAs & NPs

Play Episode Listen Later Feb 27, 2022 93:11


Welcome to Episode 14 of “The 2 View,” the podcast for EM and urgent care nurse practitioners and physician assistants! Show Notes for Episode 14 of “The 2 View” – Urticaria, Foreign Bodies, and a Special Interview Urticaria Bernstein JA, Lang DM, Khan DA, et al. The diagnosis and management of acute and chronic urticaria: 2014 update. J Allergy Clin Immunol. Published 2014. Accessed February 11, 2022. https://www.aaaai.org/Aaaai/media/MediaLibrary/PDF%20Documents/Practice%20and%20Parameters/Urticaria-2014.pdf Radecki RP, MS. Does New IV Urticaria Medication Offer Benefits Over Current Treatments? ACEP Now. Published June 15, 2021. Accessed February 11, 2022. https://www.acepnow.com/article/does-new-iv-urticaria-medication-offer-benefits-over-current-treatments/ Safety of use of high dose antihistamines in difficult-to-control chronic urticaria patients. J Am Acad Dermatol. Published May 1, 2015. Accessed February 11, 2022. https://www.jaad.org/article/S0190-9622(15)00371-0/fulltext Sarti L, Barni S, Giovannini M, Liccioli G, Novembre E, Mori F. Efficacy and tolerability of the updosing of second-generation non-sedating H1 antihistamines in children with chronic spontaneous urticaria. Pediatr Allergy Immunol. Wiley Online Library. Published August 3, 2020. Accessed February 11, 2022. https://onlinelibrary.wiley.com/doi/10.1111/pai.13325 Schaefer P. Acute and Chronic Urticaria: Evaluation and Treatment. Am Fam Physician. Published June 2017. Accessed February 11, 2022. https://www.aafp.org/afp/2017/0601/p717.html Winters M. Clinical Practice Guideline: Initial Evaluation and Management of Patients Presenting with Acute Urticaria or Angioedema. AAEM - American Academy of Emergency Medicine. Published July 10, 2006. Accessed February 11, 2022. https://www.aaem.org/resources/statements/position/clinical-practice-guideline-initial-evaluation-and-management-of-patients-presenting-with-acute-urticaria-or-angioedema Foreign Bodies & Toxic Shock Syndrome Cone LA, Woodard DR, Byrd RG, Schulz K, Kopp SM, Schlievert PM. A recalcitrant, erythematous, desquamating disorder associated with toxin-producing staphylococci in patients with AIDS. J Infect Dis. NIH. PubMed.gov. Published April 1992. Accessed February 11, 2022. https://pubmed.ncbi.nlm.nih.gov/1552193/ Contou D, Colin G, Travert B, et al. Menstrual Toxic Shock Syndrome: A French Nationwide Multicenter Retrospective Study. Clin Infect Dis. Oxford Academic. Published January 15, 2022. Accessed February 11, 2022. https://academic.oup.com/cid/article-abstract/74/2/246/6255963 Parsonnet J, Hansmann MA, Delaney ML, et al. Prevalence of Toxic Shock Syndrome Toxin 1-Producing Staphylococcus aureus and the Presence of Antibodies to This Superantigen in Menstruating Women. J Clin Microbiol. NCBI. Published September 2005. Accessed February 11, 2022. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1234102/ Shands KN, Schmid GP, Dan BB, et al. Toxic-Shock Syndrome in Menstruating Women: Association with Tampon Use and Staphylococcus aureus and Clinical Features in 52 cases. N Engl J Med. Published December 18, 1980. Accessed February 11, 2022. https://www.nejm.org/doi/full/10.1056/nejm198012183032502?casa_token=GVNPVVA8uB4AAAAA:LQTf1B8PlxwffYbLmuOeWnteCLdkKtwEydZDKn2lYW-NoNe8953D58cgSMnWVnwbN136BWtd23zr Streptococcal Toxic Shock Syndrome: All You Need to Know. Cdc.gov. Published November 23, 2021. Accessed February 11, 2022. https://www.cdc.gov/groupastrep/diseases-public/streptococcal-toxic-shock-syndrome.html Toxic Shock Syndrome (Other Than Streptococcal) (TSS) 2011 case definition. Cdc.gov. Reviewed April 16, 2021. Accessed February 11, 2022. https://ndc.services.cdc.gov/case-definitions/toxic-shock-syndrome-2011/ Foreign Bodies Continued - Management Coskun A, Erkan N, Yakan S, Yıldirim M, Cengiz F. Management of rectal foreign bodies. World J Emerg Surg. Published March 13, 2013. Accessed February 11, 2022. https://wjes.biomedcentral.com/articles/10.1186/1749-7922-8-11 O'Malley G, O'Malley R. Body Packing and Body Stuffing. Merck Manuals Professional Edition. Reviewed/Revised May 2020. Accessed February 11, 2022. https://www.merckmanuals.com/professional/special-subjects/recreational-drugs-and-intoxicants/body-packing-and-body-stuffing Guest Interview: Kenny Walks Across America Facebook. Facebook.com. Accessed February 11, 2022. https://www.facebook.com/KennywalksacrossAmerica Kenny Walks Across America. Kenny Walks Across America. Accessed February 11, 2022. http://www.kennywalksacrossamerica.com Recurring Sources Center for Medical Education. Ccme.org. http://ccme.org The Proceduralist. Theproceduralist.org. http://www.theproceduralist.org The Procedural Pause. Emergency Medicine News. Lww.com. https://journals.lww.com/em-news/blog/theproceduralpause/pages/default.aspx The Skeptics Guide to Emergency Medicine. Thesgem.com. http://www.thesgem.com Trivia Question: Send answers to 2viewcast@gmail.com Be sure to keep tuning in for more great prizes and fun trivia questions! Once you hear the question, please email us your guesses at 2viewcast@gmail.com and tell us who you want to give a shout-out to. Be sure to listen in and see what we have to share!

2 View: Emergency Medicine PAs & NPs
13 - Nystagmus, SCAD, Sotrovimab, Paxlovid, Molnupiravir, and more.

2 View: Emergency Medicine PAs & NPs

Play Episode Listen Later Jan 27, 2022 80:22


Welcome to Episode 13 of “The 2 View,” the podcast for EM and urgent care nurse practitioners and physician assistants! Show Notes for Episode 13 of “The 2 View” – Nystagmus, SCAD, Sotromivab, Paxlovid, Molnupivarvir, and more. Nystagmus Mehar A. CanadiEM Frontline Primer - Vertigo workup. CanadiEM. Published April 25, 2020. Accessed January 11, 2022. https://canadiem.org/canadiem-frontline-primer-vertigo/ Nystagmus. NeurologyNeeds.com. Accessed January 11, 2022. https://www.neurologyneeds.com/neurological-examination-tips-tricks/nystagmus/ Nystagmus. The Proceduralist. Published January 10, 2022. Accessed January 11, 2022. https://www.youtube.com/watch?v=fW3sVsNgJ2k Talmud JD, Coffey R, Edemekong PF. Dix Hallpike Maneuver. NCBI. StatPearls Publishing. Last Update December 19, 2021. Accessed January 11, 2022. https://www.ncbi.nlm.nih.gov/books/NBK459307/ SCAD Beardsell L. Preventing mid-life spontaneity becoming a crisis - SCAD as a serious cause of chest pain. St Emlyn's. St.Emlyn's Emergency Medicine. Published May 29, 2021. Accessed January 11, 2022. https://www.stemlynsblog.org/scad/ Durrani M. Spontaneous Coronary Artery Dissection (SCAD). REBEL EM - Emergency Medicine Blog. Published October 19, 2020. Accessed January 11, 2022. https://rebelem.com/spontaneous-coronary-artery-dissection-scad/ Hayes SN, Tweet MS, Adlam D, et al. Spontaneous Coronary Artery Dissection: JACC State-of-the-Art Review. J Am Coll Cardiol. Published August 2020. Accessed January 11, 2022. https://www.jacc.org/doi/abs/10.1016/j.jacc.2020.05.084 Johnson AK, Tweet MS, Rouleau SG, Sadosty AT, Raukar NP. 243 Spontaneous Coronary Artery Dissection in the Emergency Department: The Elusive Dissection. Ann Emerg Med. Published October 1, 2020. Accesseed January 11, 2022. https://www.annemergmed.com/article/S0196-0644(20)31003-9/fulltext#relatedArticles Kim ESH. Spontaneous Coronary-Artery Dissection. N Engl J Med. Published December 10, 2020. Accessed January 11, 2022. https://www.nejm.org/doi/full/10.1056/NEJMra2001524 Sotromivab, Paxlovid and Molnupivarvir Beigel JH, Tomashek KM, Dodd LE, et al. Remdesivir for the Treatment of Covid-19 - Final Report. N Engl J Med. Published November 5, 2020. Accessed January 11, 2022. https://www.nejm.org/doi/full/10.1056/nejmoa2007764 Jayk Bernal A, Gomes da Silva MM, Musungaie DB, et al. Molnupiravir for Oral Treatment of Covid-19 in Nonhospitalized Patients. N Engl J Med. Published online December 16, 2021. Accessed January 11, 2022. https://www.nejm.org/doi/full/10.1056/NEJMoa2116044 PAXLOVIDTM (nirmatrelvir tablets; ritonavir tablets): Now Authorized for Emergency Use. For Patients. Pfizer. Covid19oralrx-patient.com. Accessed January 11, 2022. https://www.covid19oralrx-patient.com/ Sotrovimab. Sotrovimab.com. GSK. Accessed January 11, 2022. https://www.sotrovimab.com/ Guest Interview: JIM ROBERTS - IVERMECTIN Bryant A, Lawrie T, Dowswell T, et al. Ivermectin for Prevention and Treatment of COVID-19 Infection: A Systematic Review, Meta-analysis, and Trial Sequential Analysis to Inform Clinical Guidelines. American Journal of Therapeutics. Lww.com. Published July/August 2021. Accessed January 11, 2022. https://journals.lww.com/americantherapeutics/fulltext/2021/08000/ivermectinforpreventionandtreatment_of.7.aspx Em-news.com. Accessed January 11, 2022. http://www.em-news.com Kory P MD, Meduri GU MD, Iglesias J, et al. Review of the Emerging Evidence Demonstrating the Efficacy of Ivermectin in the Prophylaxis and Treatment of COVID-19. Published online 2020. Updated January 16, 2021. Accessed January 11, 2022. https://covid19criticalcare.com/wp-content/uploads/2020/11/FLCCC-Ivermectin-in-the-prophylaxis-and-treatment-of-COVID-19.pdf Mike & Martha's Something Sweet: Safest Countries in the World in 2021 Safest Countries in the World 2021. Worldpopulationreview.com. Accessed January 11, 2022. https://worldpopulationreview.com/country-rankings/safest-countries-in-the-world Recurring Sources Center for Medical Education. Ccme.org. http://ccme.org The Proceduralist. Theproceduralist.org. http://www.theproceduralist.org The Procedural Pause. Emergency Medicine News. Lww.com. https://journals.lww.com/em-news/blog/theproceduralpause/pages/default.aspx The Skeptics Guide to Emergency Medicine. Thesgem.com. http://www.thesgem.com Trivia Question: Send answers to 2viewcast@gmail.com Be sure to keep tuning in for more great prizes and fun trivia questions! Once you hear the question, please email us your guesses at 2viewcast@gmail.com and tell us who you want to give a shout-out to. Be sure to listen in – this month we are giving away 20% off of our July Bootcamp Course and lunch with the faculty! Win and join us in Vegas this summer – come and share your ER experiences with us over a good meal.